Tfome Clone Information

TFome Information for pUT1749

TFome Name pUT1749
Template EC905796
Genbank Insert ID HQ858768
Protein Name ZmMYB40
Species Maize
TF Family MYB
Gene ID GRMZM2G051256
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C21 UP 3' Primer Name: C21 DN
5' Primer Tm (º C): 65.0 3' Primer Tm (º C):
5' Primer Sequence: CAC CAT GGG GAG GGC GCC 3' Primer Sequence: GAGATTGTCCAGGAAGAAgag
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGGGAGGGCGCCGTGCTGCGAGAAGGTGGGGCTGAAGAAGGGGAGGTGGACCAAGGAGGAGGACGAGGTCCTGGCGAGGTACATCAAGGAGCACGGGGAAGGATCGTGGAGGTCACTGCCCAAGAATGCCGGGCTGCTGCGGTGCGGGAAGAGCTGCAGGCTGCGGTGGATCAACTACCTGCGGGCGGGTCTCAAGAGGGGGAACATCTCGGAGGAGGAGGAGGACATGATCATCAAGCTCCACGCCACGCTTGGCAACAGGTGGTCCCTGATCGCCGGTCACTTGCCCGGTCGAACAGACAACGAGATCAAAAACTACTGGAACTCGCACCTGAGCAGGCGGGCGGCCGACTTCCGCGACGGCGTCGTCGTCGACATCGACCTCAGCAAGCTGCCCGGCGGCGGGAAACGGCGCGGCGGCCGGGCCAGCCGGGGCGCCGTCGTGGCCGCGGCCAAGGAGAAGAAGGCCAAGGAGAAGGACGACAGGGGCAATAGCAAGGTCGCAGAAGCGGAGCAGCAGCTCAGGGACACGGAGGACGACGACGGCGGCAGCGTCTCCACGCCGAGGCCTCAGTCTGATGACTGCGGCACCGCCCAGAGCGAAGAGGAGCAAGCGCAGGCCAGCGCCAGCGGCCTGACATCCGATGGGCATGGGCCCGAGGAGGAGGAGGAGGAGGACCCGCTGGCTCTGAGCGAGGAGATGGTGAGTGCGCTTCTGGCCCCGGAAAGCCCAAAGCTGGAGGTGGGCCCCGATGGCTCGTGCATGGACAGCTACAGTGGCCCTCCGTCAGGGGAAAGCGGCTGTGGGTCCAGTGGGCCTTCTGGCGACGTGGCCCAGGACCTGGACCTAGACGACGACAAGGCCATCATGGACTGGGACTTGATGGGGCTGGACATCTCGACCGCCGGTGACATGTGGGACCAGCTGGTGTGGGACTACGACGAAACGTTGGTCACGGAACCGGAAGGAGGGGAGGAAGGGCACCAGCAGCAGGACGATGTCATGTCAGACCTCTTCTTCCTGGACAATCTC
TFome clones do not contain stop codon at 3'end.
translation: MGRAPCCEKVGLKKGRWTKEEDEVLARYIKEHGEGSWRSLPKNAGLLRCGKSCRLRWINYLRAGLKRGNISEEEEDMIIKLHATLGNRWSLIAGHLPGRTDNEIKNYWNSHLSRRAADFRDGVVVDIDLSKLPGGGKRRGGRASRGAVVAAAKEKKAKEKDDRGNSKVAEAEQQLRDTEDDDGGSVSTPRPQSDDCGTAQSEEEQAQASASGLTSDGHGPEEEEEEDPLALSEEMVSALLAPESPKLEVGPDGSCMDSYSGPPSGESGCGSSGPSGDVAQDLDLDDDKAIMDWDLMGLDISTAGDMWDQLVWDYDETLVTEPEGGEEGHQQQDDVMSDLFFLDNL