Tfome Clone Information

TFome Information for pUT1755

TFome Name pUT1755
Template
Genbank Insert ID HQ858877
Protein Name OsABI33
Species Rice
TF Family ABI3-VP1
Gene ID LOC_Os05g40280
transcript
Vector pENTR/SD/D-TOPO
Note in the genomic DNA, the nucleotide is C at the 470th allele of the ORF, while it is changing to G at the same position in the entry clone.
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name: XL05g04814R
5' Primer Tm (º C): 72.3 3' Primer Tm (º C): 60.8
5' Primer Sequence: 3' Primer Sequence:
PCR Condition: Step 1, 98C 30 sec melt, 1 cycle; Step 2, 98C 10 s
Nucleotide Sequence: ATGGCGGCGGAGGCCGGCAGCGCGGCCGCCGGCGCCGCCTACGAGGAGGAGCGCCGGAAGCGGGTCCTCGAGAACCTCAAGCACCTCGAGGATCTGGGCATAAAGAAGATGTCCAAGAGCTTGCTGGAGGCGGCGAGATTGCAGAAGAGCACTCGTGCCAGCCCCAAGCCGCGGAAGAAGTTTGAGGTTGGGGCCACTGAAGTGAGGCGTTCATCGAGGGCGCGCAACTCGGTTTCGTACAAAGAGAATTTTGATGAACTCAACAGTTTTCTATGCCGTAGAAGGGGCAGTAGGATTAGGAGCACAGAGCAGGGGAGGGATTACACCGGAAGAGTTGCCTCTTATGAACAGCAACAACGTGCTTTCAAAAAAGCTGAGAGACTTCAAAATAGTCTAGACCCTGAGAACCCGTCGTTTGTTAAGACCATGGTTCGATCACATGTGTCCAGCTGCTTTTGGCTTGGTCTTCGAACTAGATTCTGCAAATTGCATCTGCCTCCCAAAGAGTATAAGATGGTCTTGGAGGATGAAGAGGGTGGTGAATTTGATTCTGTCTACATTGGGAACCGTACAGGCCTAAGTGGTGGATGGAGAGGTTTTGCGATGCACCACAACTTGGAAGATGGTGATTCATTGGTCTTTGAATTGGCTGAACCAGACAGATTTAAGATCTACATCATAAAAGCTGTTGATGAGGATGCAAATGAGTCTGAGCCTGCTGATGAGGAAGCTATTGGGGACAAGGACACCAGTACAGAGGATGCAGCTGAGCAGGATGACTCACCTAATGCTGAACCTTTAAAAGGAACTAAGAGGAGAAAACTCCGTGGACGCCGG
TFome clones do not contain stop codon at 3'end.
translation: MAAEAGSAAAGAAYEEERRKRVLENLKHLEDLGIKKMSKSLLEAARLQKSTRASPKPRKKFEVGATEVRRSSRARNSVSYKENFDELNSFLCRRRGSRIRSTEQGRDYTGRVASYEQQQRAFKKAERLQNSLDPENPSFVKTMVRSHVSSCFWLGLRTRFCKLHLPPKEYKMVLEDEEGGEFDSVYIGNRTGLSGGWRGFAMHHNLEDGDSLVFELAEPDRFKIYIIKAVDEDANESEPADEEAIGDKDTSTEDAAEQDDSPNAEPLKGTKRRKLRGRR