Tfome Clone Information

TFome Information for pUT3150

TFome Name pUT3150
Template BT054809.1
Genbank Insert ID JX469907
Protein Name ZmMYB133
Species Maize
TF Family MYB
Gene ID GRMZM2G149958
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B287_F 3' Primer Name: B287_R
5' Primer Tm (º C): 65.5 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCCGTGGACGAGGC 3' Primer Sequence: CCCATGAGATGGTGGGGG
PCR Condition: 40 sec 98°C, 30x(15sec 98°C, 30sec 45°
Nucleotide Sequence: ATGGCCGTGGACGAGGCGAGCAGCAGTGGCGGTGGGGAGGAGGGGTGCGGGTCGTGGACCCGCGAGCAGGAGAAGGCGTTCGAGAACGCGGTGGCGACGATGGGCGGGGAGGAGGACGGGGACGCGAGGTGGGAGAAGCTAGCGGAGGCCGTCGAGGGGAAGACGCCGGAGGAGGTCAGGCGGCACTACGAGCTGCTGGTGGAGGACGTCGACGGCATCGAGTCGGGCCGCGTCCCGCTTCCGGCGTACGCGGCTGACGGCGCTGCCGAGGAAGGGGGCGGTGGCGGGAAGAAGGGAAGTGGCGGAGGAGGGACCCATGGGGACAAGGGGTCGGCGAAGTCCGCCGAGCAGGAGCGTAGGAAGGGCATCGCCTGGACAGAGGACGAGCACAGATTGTTCCTCCTTGGACTTGAAAAGTATGGCAAAGGTGACTGGCGGAGCATCTCGCGGAACTTTGTGATCTCAAGGACGCCGACTCAAGTAGCTAGTCATGCACAGAAGTACTTTATCCGTCTGAACTCAATGAACAGAGAAAGGCGGCGATCAAGTATACATGACATCACCAGTGTGAACAATGGAGATCCATCAACTGCACAGGGTCCAATCACAGGCCAAACAAATGGTCAGGCTGCAAATCCTGGAAAACCATCTAAGCAATCCCCGCAGCCAGCGAATACACCTCCAGGCGTCGATGCTTATGGCACAACAATTGGACAGCCAGTTGGTGGCCCCCTTGTCTCAGCTGTTGGAACTCCCGTTACACTACCTGTTTCCGCTCCACCTCATCTGGCCTATGGCATGCGTGCCCCGGTTCCAGGAGCCGTAGTACCTGGTGCTCCAGTAAACATTGCTCCGATGCCCTATCCAATGCCACCCCCACCATCTCATGGG
TFome clones do not contain stop codon at 3'end.
translation: MAVDEASSSGGGEEGCGSWTREQEKAFENAVATMGGEEDGDARWEKLAEAVEGKTPEEVRRHYELLVEDVDGIESGRVPLPAYAADGAAEEGGGGGKKGSGGGGTHGDKGSAKSAEQERRKGIAWTEDEHRLFLLGLEKYGKGDWRSISRNFVISRTPTQVASHAQKYFIRLNSMNRERRRSSIHDITSVNNGDPSTAQGPITGQTNGQAANPGKPSKQSPQPANTPPGVDAYGTTIGQPVGGPLVSAVGTPVTLPVSAPPHLAYGMRAPVPGAVVPGAPVNIAPMPYPMPPPPSHG