Tfome Clone Information

TFome Information for pUT3443

TFome Name pUT3443
Template DV532518
Genbank Insert ID KJ726898
Protein Name ZmMYB121
Species Maize
TF Family MYB
Gene ID GRMZM2G147346
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B277_F 3' Primer Name: B277_R
5' Primer Tm (º C): 75.3 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGGCGCCGTGCTG 3' Primer Sequence: CAAGACGCTCAAGTCCCTCAT
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGGGAGGGCGCCGTGCTGCGAGAAGGAGGGGCTGCGGCGGGGCGCGTGGAGCGCCGAGGAGGACCAGCGCCTGGTGGCCTACGTCCGGCAGAACGGCCACCCCAACTGGCGCGCGCTGCCACGCCAGGCCGGCCTGCTCCGCTGCGGCAAGAGCTGCCGCCTCCGCTGGATCAACTACCTCCGCCCCGACATCAAGCGCGGCAACTTCACCCCCGACGAGGAGGCCCTCATCGTCCGCCTCCACCGCGAGCTCGGCAACAGGTGGTCAGCGATCGCGGCGCAGCTGCCGGGGCGCACCGACAACGAGATCAAGAACGTGTGGCACACCCACATCAAGAAGCGCCTGGAGGACGGCCACGGGGAGGAGAAGAAGGCGCGCAAAGGCAAGCCCGCCGCCAAGAAGGCCGCCGACGCCGTGGGCCGCAGCAGCGAGCACGGGCCGTTCCTGACCGCGTCGCCGGGGCTGTCGAGCAGCGGCGTCACGTTCTCCGCCGCGGCGGACTCCGCCGCGGCCGTGTCGTCGTCGGCCGACAACGCGGCCACCACCAGCCACCACCCGCAGCAGGTCGGCGCCAGCAAGGCGGAGTCGTCGACGGAGTTGGACAGCGGCCTCAGCTCCGCCGAGTTCCCGCCCCTCGACGACAGCTTCTGGTCGTCGGCGGACGTCGTGGACATGGGCCTCGGCGCCACGGACGAGGAGCTGGGCCTCGCGTGCCCGCCGCCGCTGTCGTCGTCGTCCACCAGGGACGAGGACATGGAGTTCTGGCTCAACATGCTGCTGGAGGCCGGCGACATGAGGGACTTGAGCGTCTTG
TFome clones do not contain stop codon at 3'end.
translation: MGRAPCCEKEGLRRGAWSAEEDQRLVAYVRQNGHPNWRALPRQAGLLRCGKSCRLRWINYLRPDIKRGNFTPDEEALIVRLHRELGNRWSAIAAQLPGRTDNEIKNVWHTHIKKRLEDGHGEEKKARKGKPAAKKAADAVGRSSEHGPFLTASPGLSSSGVTFSAAADSAAAVSSSADNAATTSHHPQQVGASKAESSTELDSGLSSAEFPPLDDSFWSSADVVDMGLGATDEELGLACPPPLSSSSTRDEDMEFWLNMLLEAGDMRDLSVL