Tfome Clone Information

TFome Information for pUT3446

TFome Name pUT3446
Template BT055234.2
Genbank Insert ID KJ726901
Protein Name ZmMYB128
Species Maize
TF Family MYB
Gene ID GRMZM2G017520
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B298_F 3' Primer Name: B298_R
5' Primer Tm (º C): 72.4 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGCACTCCTGCTGTT 3' Primer Sequence: GATATTCTCAAAAGACAAGGACATCCTTT
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGGGAGGCACTCCTGCTGTTACAAGCAGAAGCTGAGGAAGGGGCTCTGGTCTCCTGAGGAAGATGAGAAGCTCATGAACCACATAACCAAGCACGGGCATGGCTGCTGGAGCACTGTCCCCAAGCTTGCAGGGCTTCAGAGGTGTGGCAAGAGCTGCAGGCTGAGGTGGATAAATTACCTGAGGCCTGACCTTAAAAGAGGCGCATTCTCTGAGGAGGAGGAAGACCTCATCGTCGAACTTCATGCTGTACTGGGGAACAGGTGGTCTCAGATTGCAACAAGGTTGCCTGGAAGAACTGACAACGAGATTAAGAATCTCTGGAACTCGAGCATCAAGAAGAAGCTCCGGCAGAAAGGCATTGACCCCAACACCCACAAGCCGCTCCTTGTCGAGGTTGAACGCAGCAAAGCAGCTCCAACGACCAGTACCGAGAGGACCTCTGAGTCCAGTGATGTTGACCCTTCAAGTGGCGGCGCACTTGGCAACTCGAGCCATCTTCTTCTCAGCGAGACAGCACAATCACCACAGCTGCCAGCGCTCGGTAAGCATCGCAGAGAAACTACTAGCCTCGCACATCTAAGGGTGCCGCCCAAGGAGTTGTTCCTTGACCAGCTGGTTTCTGGTCATGAGAACCTCACTGGCTGCCGCACAGCAGGCCCAGTTCCAAATTTCCCTTTCCAACAGCTCATGTGCTACAGCAATGAATTTGGCAACAAGAATGGTGCTAGTAACAATTCACTCTGGTTTAACCACAATGAGACAAGTGGCAGCACCATTTCCACTGTGATGCCACCAGTTTCGCCATCAACTCTCTCAACATCAACAGGGCTCAATAGGTCACCAGACAACCCACACTCGGGAGGCACTGGTATTCAGAGCACCCAGTTCTACTGGGACACTGCTAATCCTAGCAGCTGCAGCAGTAGAGGAAGCAGCGGAAGCAACGGCTTGGGATTTGAGCTGCAAAGCACAAGCTCGCTTCTGGAGAGTAGTGTTTTCCCATGGACAGAATTAACACCAGACAAAAATAGCCAAGTTCACCTTGGGGAAGAACTCAAGTGGCCCGACTTGCTCCACGGAACATTCACGGACACACCTGCAACCATGCAGAATCTTAGCCAGTCACTGTACGAAGATGTTATCAAAGCCGAGAGCCAATTCAACATAGAGGGCCTCTGTGCAGCCTGGTCTCAAAATCTGCAGCCACAGCAACATCTGCAGGTATCAGATTTGTATGACAAGGATTTGCAAAGGATGTCCTTGTCTTTTGAGAATATC
TFome clones do not contain stop codon at 3'end.
translation: MGRHSCCYKQKLRKGLWSPEEDEKLMNHITKHGHGCWSTVPKLAGLQRCGKSCRLRWINYLRPDLKRGAFSEEEEDLIVELHAVLGNRWSQIATRLPGRTDNEIKNLWNSSIKKKLRQKGIDPNTHKPLLVEVERSKAAPTTSTERTSESSDVDPSSGGALGNSSHLLLSETAQSPQLPALGKHRRETTSLAHLRVPPKELFLDQLVSGHENLTGCRTAGPVPNFPFQQLMCYSNEFGNKNGASNNSLWFNHNETSGSTISTVMPPVSPSTLSTSTGLNRSPDNPHSGGTGIQSTQFYWDTANPSSCSSRGSSGSNGLGFELQSTSSLLESSVFPWTELTPDKNSQVHLGEELKWPDLLHGTFTDTPATMQNLSQSLYEDVIKAESQFNIEGLCAAWSQNLQPQQHLQVSDLYDKDLQRMSLSFENI