Tfome Clone Information

TFome Information for pUT3686

TFome Name pUT3686
Template BT064133.1
Genbank Insert ID KJ726985
Protein Name ZmNAC26
Species Maize
TF Family NAC
Gene ID GRMZM2G113950
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: UT2538up 3' Primer Name: UT2538dn
5' Primer Tm (º C): 60.1 3' Primer Tm (º C):
5' Primer Sequence: caccATGAGCCTGTCACCGCTCG 3' Primer Sequence: CCTGCTGTAGATACACGACCCTACT
PCR Condition:
Nucleotide Sequence: ATGAGCCTGTCACCGCTCGACTCCTCCTCCCCGCCGGCCGCGGCTGCGGCTGCTGCTACGGAGGTGCCCCTCGCCCCGGGCTTCCGCTTCCACCCCACCGACGAGGAGCTCGTCTCCTACTACCTCCGCCGCCGCGTCCTCGGCCGCCGCCTCCGCGTCGACGCCATCGCCGAGATCGACCTCTACCGCCTCGAGCCCTGGGACCTCCCCTCCCTCTCCCGCATCCGCAGCCGCGACGCCCAGTGGTACTTCTTCGCCCGTCTCGACCGCAAGGTCGCCGGCGCTGGCGCCGGGGGCCGGGGCGGTCCCGGCAACAGGACCAACCGCGCTACGCCGAGGGGGTACTGGAAGACCACGGGCAAGGACCGCGAGGTGCACCACCGCGGCAAGCCCGTCGGGATGAAGAAGACGCTCGTCTTCCACGCCGGGAGGGCGCCTAAGGGCGAGAGGACCAACTGGGTCATGCACGAGTACCGCCTCCTCGATGCAGACGGACCTCAGGATCTGCATGTGGTTTGTAGAATCTTCCAGAAGCATGGGTCTGGACCACAGAACGGTGCGCAGTATGGTGCACCATACATGGAAGAGGAATGGGAAGAGGATGATGATGCTATTGAGAATGGTTCTACCCACGATGCATCTGGTCAAATTGCTGCAACCACCTGTGCTGTAGATGAGGAGTCAAATGAGGACGATGAGAATGCATATTGTGAAACAAACAGACCTGCTCGAGTAGAACCATCTCATCTGCCTTCGGTCCATGAAATGCTCAATCCACCAGAGATGGCTCCTCTCCAAGGTCAAGATTCTAAAGAGACAAGCGATGGAAGTTGTTCTGATGTTGCTATTTCTCTGGAAGAGATTTTGCAGGAACCTTTGTCAAATATTAGTGTGGAGAATATGCATAGACTTGAAGGGCAGAATGCCACTGATGATAACATCAGTGTTGATAACTTGTTATCAGCATATCCCACGAAAGATAATGGCTACGTAGGCCAGTATAACACTATGAATGGGAGTGCTCCAGCAGATGAAGCTCACGCACGCTGGCCTTTGAGAACATATAGTAATCAGAATTATGTCAATGGCCCTCTTGCTGATGAGTTCTTTGACACAGGGAATGATACCAATGGGGTTGCATATTCCAGGCAGCAGCAAGCTGATGGCTTCCCAGCACCTCGCCAAGTTGATGAAAGTATGGTATTTTATGATGCCCCATCTGATTACAACTTGGTGGATGGAAAAGATGACTTCGTATATCTGAACGACATTCTGAATGAGCCACTTGGAAATGAATCGCTCTTTGATGGAGATGATATGATGGCTTACTTTGATGCCACAGAGAATGATTTCAAGTATGACATTTTGGGCTCTGGTCAGGGTTTGGATTATCCACTTGCAGACATGCCGTTGAACTTTGCCCAAAAGAGTGACAAGGAAGACAAGTTTACATTCGAAGGGATCTCTGAGGTTCCGGAAGCAAATCCTCAGTACGGTGCATCCTCATCTGGTTCACATGAAGATCTGTATACTGATACTGAATTTCTAGGTGTACCAACAGATGACACTGCTGATAAAACTTACGGAAATCGCCTGGCCAGCATGTTAGGCTCTATCCCAGCTCCACCTGCAATGGCCTCAGAATTCCCGCCGTCAACAGGGAAATCTGCTGGGATGCTTTCGGCTGTCAGCTCGAGCTCAATTCGTTTTACTGCTGGTATCATCCAACTTGATGGCCTCACTTTCAGCAGCGGCTCCGGTCAGTGGCCCTTGCAGAAGAATGGAGACTTGAGTTTGCTTGTCTCTTTTGCTGTGGAGGGCGACGTGGCATCCAAGCTCCCTGTTGGTCTTGGGCGTGCTACTCGGATTAGCACCGTTCCCATGGTGCTGCGCAGTGGTTTTTACCTTTTCTTTATGTCGGCCATGATTCTCTTGTTTAGCTACAAAGTAGGGTCGTGTATCTACAGCAGG
TFome clones do not contain stop codon at 3'end.
translation: MSLSPLDSSSPPAAAAAAATEVPLAPGFRFHPTDEELVSYYLRRRVLGRRLRVDAIAEIDLYRLEPWDLPSLSRIRSRDAQWYFFARLDRKVAGAGAGGRGGPGNRTNRATPRGYWKTTGKDREVHHRGKPVGMKKTLVFHAGRAPKGERTNWVMHEYRLLDADGPQDLHVVCRIFQKHGSGPQNGAQYGAPYMEEEWEEDDDAIENGSTHDASGQIAATTCAVDEESNEDDENAYCETNRPARVEPSHLPSVHEMLNPPEMAPLQGQDSKETSDGSCSDVAISLEEILQEPLSNISVENMHRLEGQNATDDNISVDNLLSAYPTKDNGYVGQYNTMNGSAPADEAHARWPLRTYSNQNYVNGPLADEFFDTGNDTNGVAYSRQQQADGFPAPRQVDESMVFYDAPSDYNLVDGKDDFVYLNDILNEPLGNESLFDGDDMMAYFDATENDFKYDILGSGQGLDYPLADMPLNFAQKSDKEDKFTFEGISEVPEANPQYGASSSGSHEDLYTDTEFLGVPTDDTADKTYGNRLASMLGSIPAPPAMASEFPPSTGKSAGMLSAVSSSSIRFTAGIIQLDGLTFSSGSGQWPLQKNGDLSLLVSFAVEGDVASKLPVGLGRATRISTVPMVLRSGFYLFFMSAMILLFSYKVGSCIYSR