Tfome Clone Information

TFome Information for pUT4200

TFome Name pUT4200
Template Synthesized template
Genbank Insert ID KJ727090
Protein Name ZmMYB102
Species Maize
TF Family MYB
Gene ID GRMZM2G392823
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 3' Primer Tm (º C):
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGATGAAGAAGGGCAAGTGGTCCAAGGCCGAGGACGAGCTGATCATCAACCACATCCAAAGGCACGGCGGCATTGGCCTTGGGAGATGCGGCAGATCTTGCAGGTCACGCTGGCTGAACTACCTGAGGCCAGGCCTTAAGCACGGCCACTTCACTCCAGCTGAGGACAGGATCATCTGCGAGATGTACAGGCGCAAGGGCAGCTGCTGGTCTGTGATCGCTGCTCAACTTCCAGGCAGGACCGACCTGGCCGTGAAGAACTACTGGAACAGCACCCTGAAGAAGAAGTACAGGCCACTGCCAGCCGCTAGGACTGCTGCTGCTGCTACTTGGAGAAGGCACAGGGCTTGCGCTGCTGACAGCACCTCTTCTGATGCTGGCGTTCCAGCTAGGGGCCTTCAACCAGCTGTTTGCTCATCTGGCGGCAGCAGCAGCTCTGAGGAGTCATCTACTGCTGGCAGCAGCTCCCCAGTGAAGCCAGTTCTTGCTGGCCCAACCACTCCAGTGCCACTGGCTGCTGCTTCTCAAGAGCCAGTGGCTAGCGTTCCAGCTTCTGGCCCAGCTGTGCTGTTCGAGCAAAAGCCAGCTCTGGTGGGCAGGCTGCCACTTGAGAAGACTCCACCACTTCCGCCACCACCAGCTGGCGGCCAAACTGGCGGCGGCCTTATGGATATTGTGTGCAGGCCACTGAGCCCGATCCCGCTGTCTTTCATGGAGTCTGAGCTGCTGGCTTGCATCGACGGCTTCGACGATACCGACAGCTTCCTGCCATGGTTCGACCAGCAT
TFome clones do not contain stop codon at 3'end.
translation: MMKKGKWSKAEDELIINHIQRHGGIGLGRCGRSCRSRWLNYLRPGLKHGHFTPAEDRIICEMYRRKGSCWSVIAAQLPGRTDLAVKNYWNSTLKKKYRPLPAARTAAAATWRRHRACAADSTSSDAGVPARGLQPAVCSSGGSSSSEESSTAGSSSPVKPVLAGPTTPVPLAAASQEPVASVPASGPAVLFEQKPALVGRLPLEKTPPLPPPPAGGQTGGGLMDIVCRPLSPIPLSFMESELLACIDGFDDTDSFLPWFDQH