Tfome Clone Information

TFome Information for pUT5354

TFome Name pUT5354
Template BT087447.1
Genbank Insert ID KJ727495
Protein Name ZmMYB139
Species Maize
TF Family MYB
Gene ID GRMZM2G087955
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B288_F 3' Primer Name: B288_R
5' Primer Tm (º C): 70.6 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCGGCGTCGCCTTCCCC 3' Primer Sequence: GTCGATCTCGGCCATGCCCATCAC
PCR Condition: 40 sec 98°C, 30x(15sec 98°C, 30sec 58°
Nucleotide Sequence: ATGGCGGCGTCGCCTTCCCCGTCCGGCAGCGGCGGCGGCAAGGCCGGCGTGGACCGGATCAAGGGCCCCTGGAGCCCCGAGGAGGACGAGGCCCTGCAGCGCCTCGTGCGCCGCCACGGCGCGCGCAACTGGTCCCTCATCAGCCGCTCCGTCCCGGGCCGGTCCGGCAAGTCGTGCCGCCTCCGGTGGTGCAACCAGCTGTCGCCGCGGGTGGAGCACCGCCCCTTCACGCCCGACGAGGACGACGCCATCCTCCGCGCGCACGCCAGGTTCGGCAACAAGTGGGCCACCATCGCGCGCCTCCTCTCCGGACGCACGGACAACGCCATCAAGAACCACTGGAACTCCACGCTCAAGCGCGAGCGCGAGCGCAAGCGCGAGTACTACGCCGATGCGCGCCCCGGCCCCGGCGACCAGCGCTCGCTCAAGCGCACCAGCAGCGACGGGCCCCCCGGAAGCCCGTCCGGGTCCGACCTCAGCGACTCCAGCCACCAGAGCCTTCCCACCGTGATGCCGTCAGCCGCTTCTACCGCCGTCACCTCCCAGCAGCAGCTACAACACGTGTACTACCGCCCCGTGCCGCGCGCGGGCGGCGTGGTCCTGCTCCCGGTGGCGCCGCCTTCTCCGCAGGCTCCTCCAGCAACCTCCTTGTCGTTGTCCCTCTCCCTGCCAGGGCTGGACCAGCAGCCCGAACCATCCCCGCCGCCGCCGCCAACACCTCAAGCACAAGCAAGCTCGCCGTTGAGCGCGGAGTTCCTGTTGATGATGCAGGAGATGATCCGGATCGAGGTCCGGAACTACATGTCCGGGTCGGGCTTCGACGCACACGCCGTGATGGGCATGGCCGAGATCGAC
TFome clones do not contain stop codon at 3'end.
translation: MAASPSPSGSGGGKAGVDRIKGPWSPEEDEALQRLVRRHGARNWSLISRSVPGRSGKSCRLRWCNQLSPRVEHRPFTPDEDDAILRAHARFGNKWATIARLLSGRTDNAIKNHWNSTLKRERERKREYYADARPGPGDQRSLKRTSSDGPPGSPSGSDLSDSSHQSLPTVMPSAASTAVTSQQQLQHVYYRPVPRAGGVVLLPVAPPSPQAPPATSLSLSLSLPGLDQQPEPSPPPPPTPQAQASSPLSAEFLLMMQEMIRIEVRNYMSGSGFDAHAVMGMAEID