Tfome Clone Information

TFome Information for pUT5381

TFome Name pUT5381
Template Genomic DNA
Genbank Insert ID KJ727522
Protein Name ZmMYB107
Species Maize
TF Family MYB
Gene ID GRMZM2G172575
transcript T01
Vector pENTR/SD/D-TOPO
Note c.C808T p.P270S Not present in functional domain.
Request Information: Deposited to ABRC
5' Primer Name: SE0068_F 3' Primer Name: SE0068_R
5' Primer Tm (º C): 59.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGCATGTCAGCATGTGTATATATAACC 3' Primer Sequence: GCTAAAACAGCATGGACAGTGAGCAG
PCR Condition: Step 1, 98°C 3 min melt, 1 cycle; Step 2, 98&d
Nucleotide Sequence: ATGCATGTCAGCATGTGTATATATAACCGTCGTCACACACACGCTAGCTTCAAGGAACAGGGGGGACGATCAGATCGGAGGAGGAAGATGGAGAGCAGGCCGCCAATGCCATGGTGCGCGTGCGACAGGGCGGGGACGACGACGACGATGACGACGGCGATAAAGAAGGGGCCATGGATGCCGGAGGAGGACCTCGTCCTCGTCTCCTACATCCACGAGCACGGCCCCAGCAAGTGGCGCCACGTGGCCGCGAGCACGGGGCTCATGCGCTGCAGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCGGGCATCCGGCGCGGCCACTTCACGGCGCGCGAGGAGCGCGTCATCGTCCACCTCCACTCCCTGCTGGGCAACCGGTGGGCGGCCATCGCGTCGCATCTCCCCCAGCGCACCGACAACGACATCAAGAACTACTGGAACACCCACCTCAAGAAGAAGAAGGTCGTCGTCGAGGAACAGCAGCGAGCGGCTGCAGCAGCAGCCAAACGACACGTCGACGACGGCGGCATCACCACCAGTCGTAGTCCCCGCCTGCTCGCCAAGGACGATAGCTATGGCTACGACTACGACGCGCGCCCAGCTGCAGCCTATCCCTGTACCATGGACAACGTATCCAAGCCTCTCAAAGTCAAATTAGGTTGCATGAAGAGCGCATCGTCATCATCCCCGCCGGCGCAGGATGGTAGTAGTAGTATCCGTCGTCCTTTCTTTTCACTCGACCAAACGTCCGGCAGTACGGCGCCGCTGCCACCCATCTCCAACGTTGTGCCGCAGTCGGTGTTGGCGGGACAGGGACGACACGGCGGGCGTTTCTTCCACGAGCCGCCCCAGCAGCAGCTGTCCTCAATAATGGAGAACTGGTTATTCCTCCCCAAGCAGCAGCACCAGCAGCAGATGACGGCGAGCTCTCCGACTCCGACGGCTGCTGCTCACTGTCCATGCTGTTTTAGC
TFome clones do not contain stop codon at 3'end.
translation: MHVSMCIYNRRHTHASFKEQGGRSDRRRKMESRPPMPWCACDRAGTTTTMTTAIKKGPWMPEEDLVLVSYIHEHGPSKWRHVAASTGLMRCSKSCRLRWTNYLRPGIRRGHFTAREERVIVHLHSLLGNRWAAIASHLPQRTDNDIKNYWNTHLKKKKVVVEEQQRAAAAAAKRHVDDGGITTSRSPRLLAKDDSYGYDYDARPAAAYPCTMDNVSKPLKVKLGCMKSASSSSPPAQDGSSSIRRPFFSLDQTSGSTAPLPPISNVVPQSVLAGQGRHGGRFFHEPPQQQLSSIMENWLFLPKQQHQQQMTASSPTPTAAAHCPCCFS