Tfome Clone Information

TFome Information for pUT5393

TFome Name pUT5393
Template BT042611
Genbank Insert ID KJ727533
Protein Name ZmMYB94
Species Maize
TF Family MYB
Gene ID GRMZM2G056407
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B312_F 3' Primer Name: B312_R
5' Primer Tm (º C): 65.8 3' Primer Tm (º C):
5' Primer Sequence: caccATGGTGAGGCCGCCGTG 3' Primer Sequence: GAAGGGGTAATCCATGGGG
PCR Condition: PCR Reaction Mix: 5 l GC buffer (NEB) 1 l primer f
Nucleotide Sequence: ATGGTGAGGCCGCCGTGCTGCGACAAGGAGGGCGTCAAGAAGGGGCCATGGACGCCGGAGGAGGACCTCGTCCTCGTCTCCTACATCCAGGAGCACGGCCCCGGCAACTGGCGCGCCGTCCCGGCCAGAACCGGGCTGATGCGGTGCAGCAAGAGCTGCCGTCTGCGGTGGACCAACTACCTCCGGCCGGGCATCAAGCGCGGCAACTTCACCGAGCAGGAGGAGAAGCTCATCGTGCACCTCCAGGCCCTCCTCGGCAACAGGTGGGCGGCCATCGCGTCGTACCTGCCGGAGCGGACGGACAACGACATCAAGAACTACTGGAACACGCACCTCAAGCGCAAGCTGCAGAGCGGCGGCGACGGGGCGGCCAAGCCGCCGGCGCACAGGCCGCCGTCGTCGTCCAAGGGCCAGTGGGAGAGGAGGCTGCAGACGGACATCAACCTGGCGCGCCGCGCGCTTCGCGAGGCCCTCACCCCGCTCGACGACCTCAAGCCGCAGCTGCAGCGCGACGCCGCCGCCGACGCGCCGGCCGCTGGCGCGGGCACGGGCGGCGGTGACAGCCCGGCTTCGAGCTCGTCGGGCGCGTCGCAGTCCTCCCCTTTGGCGCCAGCGGCCTTCGCCGCCGCCGCCGCGGGGCCGTACGTTCTCACCGCGGAGAACATCTCGCGGATGCTGGACGGGTGGGCTGGCCGGAAGGTCCGCGGCGGCGGGACCCCGGGCACCCCCGGCGGTGCCGAGAGCGCGTCCACGGGATCCTCGGACGCGTCGGAGGTGTCGTACGGTGGCGCCGCCGTCGCATCGGCCGCGCCGGCGCCCGCTTGTGGTGGGCCGGTCTTCGAATACGAGGCGAAGCCGGGCGTGCCGACGTCCCATCAGCAGATGCCGCTGTCGGCGATCGAGTCGTGGCTGTTCGACGACGACAGCCACTTGCACCATGCTGTCCAGAGCGCCAGCTTGCTCGATGCCGCCCCCATGGATTACCCCTTC
TFome clones do not contain stop codon at 3'end.
translation: MVRPPCCDKEGVKKGPWTPEEDLVLVSYIQEHGPGNWRAVPARTGLMRCSKSCRLRWTNYLRPGIKRGNFTEQEEKLIVHLQALLGNRWAAIASYLPERTDNDIKNYWNTHLKRKLQSGGDGAAKPPAHRPPSSSKGQWERRLQTDINLARRALREALTPLDDLKPQLQRDAAADAPAAGAGTGGGDSPASSSSGASQSSPLAPAAFAAAAAGPYVLTAENISRMLDGWAGRKVRGGGTPGTPGGAESASTGSSDASEVSYGGAAVASAAPAPACGGPVFEYEAKPGVPTSHQQMPLSAIESWLFDDDSHLHHAVQSASLLDAAPMDYPF