Tfome Clone Information

TFome Information for pUT5434

TFome Name pUT5434
Template BT036751
Genbank Insert ID KJ727574
Protein Name ZmWRKY29
Species Maize
TF Family WRKY
Gene ID GRMZM2G040298
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B770_F 3' Primer Name: B770_R
5' Primer Tm (º C): 64.7 3' Primer Tm (º C):
5' Primer Sequence: caccATGGACGCCGAGTGGAGC 3' Primer Sequence: CTTCACCCGGCCTGCCAC
PCR Condition: 40 sec 98°C 30x : 15 sec 98°C 30 sec 58&de
Nucleotide Sequence: ATGGACGCCGAGTGGAGCGGCGACGAGAGCAAGGCTGGCGCTGCGGGCGGAGTTTCGTCGGCTGATTGCCCAAGTTCGCCACCGCCGGTGTCGCCGGCGCCACCGTCCACGTCGCCAGCTGCTACCGGTGCCGGGAGGAGGCGGTCGGCGAACAAGCGGGTGGTCACCGTGCCGCTGGCGGACGTCAGTGGCCCACGGCCCAAGGGCGTCGGCGAGGGCAACACGCCGACGGACGCGTGGGCGTGGCGCAAGTACGGCCAGAAGCCCATCAAGGGCTCGCCTTTTCCGAGGGCTTACTACAGGTGCAGCAGCTCCAAGGGGTGCCCGGCCAGGAAGCAGGTGGAGCGGAGCAGGGCGGAGCCGGACAAGGTGATCGTCACGTACTCGTTCGAGCACAGCCACTCGGAGGCCATGGCGGCGGCGAGGGCGCAGAACCGCCAGGCCCCGAAGCCAAAGCCGGCCCAGCCACAGCCAGTCCCGCCGGAGTCCCCGTCATCCGGCAGCCACGACGTCGCTGCCGCTGCCACGGTCGTCTGCGCGCCTGCTGCGGCCGAGACCGAGGCCGGCGCGGCGGCCGTCGAGGTGCACGACGAGTTCAGGTGGCTCTACGACGGCGTGTCCGTCACCTCCTCGGCGTCCCCACCGGACGTCGAGGCGGCGGACGAGATGCTGTACGGGGCGATGTTCTTCGGCGCCCCGCCCGCGCCCCTCCCCGACGAGTTCGGCGACGTCGGCGGGCTGTTCGACGGAGAAGGGGGCGAGGAGGACGCCATGTTCGCGGGTCTCGGCGAGCTGCCCGAGTGCGCCATGGTGTTCCGGCGGCACGCCGGCGACGGGATTTCGGTGGCAGGCCGGGTGAAG
TFome clones do not contain stop codon at 3'end.
translation: MDAEWSGDESKAGAAGGVSSADCPSSPPPVSPAPPSTSPAATGAGRRRSANKRVVTVPLADVSGPRPKGVGEGNTPTDAWAWRKYGQKPIKGSPFPRAYYRCSSSKGCPARKQVERSRAEPDKVIVTYSFEHSHSEAMAAARAQNRQAPKPKPAQPQPVPPESPSSGSHDVAAAATVVCAPAAAETEAGAAAVEVHDEFRWLYDGVSVTSSASPPDVEAADEMLYGAMFFGAPPAPLPDEFGDVGGLFDGEGGEEDAMFAGLGELPECAMVFRRHAGDGISVAGRVK