Tfome Clone Information

TFome Information for pUT5435

TFome Name pUT5435
Template BT067017
Genbank Insert ID KJ727575
Protein Name ZmHB115
Species Maize
TF Family Homeobox
Gene ID GRMZM2G021339
transcript T01
Vector pENTR/SD/D-TOPO
Note c.A605G p.E202G SNP present in template FlcDNA, not in functional domain.
Request Information: Deposited to ABRC
5' Primer Name: B773_F 3' Primer Name: B773_R
5' Primer Tm (º C): 64.1 3' Primer Tm (º C):
5' Primer Sequence: caccATGGAGTCCGGACGGCTC 3' Primer Sequence: GTTCCACATCCACCACCAGCTG
PCR Condition: 40 sec 98°C 30x : 15 sec 98°C 30 sec 60&de
Nucleotide Sequence: ATGGAGTCCGGACGGCTCATCTTCAACGCGCCCGGCTCCGGCGCCGGGCAGATGCTCTTCCTGGACTGCGGCGCAGGCGGTGGTCCCGGCGGCGGCTTGTTGCATCGAGGCGGGAGACCGATGCTTGGCCTTGAAGAAGGGCGCGGCGTAAAACGGCCCTTCTACACCTCGCCCGACGAGCTCCTCGAGGAGGAGTACTACGACGAGCAGCTGCCGGAGAAGAAGCGCCGCCTGACGCCGGAGCAGGTGCACCTGCTGGAGAGGAGCTTCGAGGAGGAGAACAAGCTGGAGCCGGAGCGCAAGACGGAGCTGGCGCGCAAGCTGGGCCTGCAGCCCCGGCAGGTGGCCGTGTGGTTCCAGAACCGGCGCGCCCGGTGGAAGACCAAGCAGCTGGAGCGCGACTTCGACCGCCTCAAGGCCTCCTTCGACGCCCTCCGCGCGGACCACGACGCCCTTCTCCAGGACAACCACCGCCTCCGCTCACAGGTGGTGTCGTTGACCGAGAAGCTGCGAGAGAAGGAGGCGACGGAGGGCGACGCCAACGGCGCCGCGGCGGCGTTGCCGGCGGTGGGCGTTGTCAGGGCTTCCGTGGCCGATGACGTCGGGGAACCGGAGCCGGAGCCGGAGCCGGAGGCAGAGGCGGCGGCGTTCGAGGAGCGGCAGGTGAAGTCCGAGGACAGGCTGAGCACGGGCAGCGGCGGGAGCGCGGTGGTGGACGCGGCGGACGCGCTGTTGTACAACGGCAGGATCGGCGGCGCGGCCGTCGATAGCAGCGTCGAGTCGTACTTCCCCGGCGCCGAGGTCCAGGACCAGTACCACGGCTGCGGGACGATGGGTCCAGTAACCCACGGCGCTGGAGGCATCCAGTCGGACGACGACGACGGCGCCGGCAGCGACGAGGGATGCAGCTACTACGCCGACGAAGAAGCCGCCGCCGCGTTCCTCTCCGAACACACCCACCACGCGGACGGCGACGACGAGGACGCCGGCCAGGTCAGCTGGTGGTGGATGTGGAAC
TFome clones do not contain stop codon at 3'end.
translation: MESGRLIFNAPGSGAGQMLFLDCGAGGGPGGGLLHRGGRPMLGLEEGRGVKRPFYTSPDELLEEEYYDEQLPEKKRRLTPEQVHLLERSFEEENKLEPERKTELARKLGLQPRQVAVWFQNRRARWKTKQLERDFDRLKASFDALRADHDALLQDNHRLRSQVVSLTEKLREKEATEGDANGAAAALPAVGVVRASVADDVGEPEPEPEPEAEAAAFEERQVKSEDRLSTGSGGSAVVDAADALLYNGRIGGAAVDSSVESYFPGAEVQDQYHGCGTMGPVTHGAGGIQSDDDDGAGSDEGCSYYADEEAAAAFLSEHTHHADGDDEDAGQVSWWWMWN