TFome pUT5436
Template BT037235
Genbank Insert ID KJ727576
Protein Name ZmWRKY3
Species Zea mays
TF Family WRKY
Gene id GRMZM2G130374
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information Deposited to ABRC
Subgenome: 1

TFome pUT5436

Placeholder text:
"TFome" is used as a synonym for "clone".
"TFome" is short for "transcription factor open reading frame".

5' Primer

Name B776_F
Temperature (ºC) 63.4
Sequence
Copy to clipboard
caccATGGAGGAGGTGGAGGTGG

3' Primer

Name B776_R
Temperature (ºC)
Sequence
Copy to clipboard
CGTCTGGGTGGAAGGCTGCG

PCR Condition

40 sec 98°C 30x : 15 sec 98°C 30 sec 58&de

Amino Acid Sequence
Copy to clipboard

MEEVEVANRAAVESCHRVLALLSQQRDPALLKSVASETAEACAKFRKVAALLGSGVGHARGRFSRRVRPLGLVGHKSPVGSGGNNPVEMLPSAAAVTSPSPSTSYPPQMRARLNGVPDPRGLDMACSSSSKSGGVGGGGAHPFGGAPKLVQPLSVQFQIGNVAHRYPFHQQPPSRQKLQAAEMFRRSSSGTISLKFDSPIPSGGGGAAGTVSFVSSLSMDGSVGVASLDGKRPFHLVGTPVAASDTAADAHRAPKRRCTCRGGEEDGRGNKCGTSGRCHCSKRRKLRIKRSIKVPAISNKVADIPPDEYSWRKYGQKPIKGSPHPRGYYKCSSVRGCPARKHVERCVDDPAMLIVTYEGEHGHTQLPAQPSTQT

TFome clones do not contain stop codon at 3'end.

CDS
Copy to clipboard

ATGGAGGAGGTGGAGGTGGCCAACCGGGCCGCGGTGGAGAGCTGCCACCGTGTGCTGGCCCTGCTCTCGCAGCAGCGGGACCCGGCCCTGCTCAAGAGTGTAGCGTCAGAGACGGCCGAAGCCTGCGCCAAGTTCAGGAAGGTAGCCGCCCTCCTCGGCAGCGGTGTCGGCCACGCTAGAGGCAGGTTCTCCAGACGAGTCCGGCCTCTGGGGCTCGTTGGCCACAAGAGCCCCGTGGGGAGCGGCGGCAACAACCCGGTGGAGATGCTGCCCAGCGCCGCCGCCGTTACGTCCCCGTCTCCGTCAACCAGCTACCCGCCGCAAATGCGCGCTCGGCTGAACGGCGTGCCAGACCCACGAGGGCTGGACATGGCCTGCTCCAGCAGCAGCAAGAGCGGCGGCGTTGGCGGAGGCGGCGCTCATCCATTCGGCGGAGCGCCGAAGCTGGTGCAGCCGCTGTCCGTGCAGTTCCAGATCGGGAACGTCGCGCACAGGTACCCGTTCCACCAGCAGCCGCCGTCGCGGCAGAAGCTGCAGGCCGCCGAGATGTTCAGGAGGAGCAGCAGCGGGACGATCAGCCTCAAGTTCGATAGCCCAATCCCTAGCGGTGGCGGTGGCGCCGCTGGCACCGTGTCGTTCGTGTCGTCCTTGAGCATGGACGGGAGCGTGGGCGTGGCAAGCTTGGACGGGAAGCGGCCGTTCCATCTGGTCGGCACCCCGGTGGCGGCGAGCGACACGGCGGCAGACGCCCACCGCGCGCCCAAACGCCGGTGCACGTGTAGAGGAGGCGAGGAGGATGGGAGAGGCAACAAGTGCGGCACCTCCGGCAGGTGCCATTGCTCAAAGAGAAGGAAGCTGCGGATCAAGAGGTCGATCAAAGTGCCAGCCATCAGCAACAAGGTCGCCGACATACCTCCCGACGAGTACTCGTGGCGCAAGTACGGGCAGAAGCCGATCAAGGGCTCCCCGCACCCGAGGGGCTACTACAAGTGCAGCAGCGTCAGGGGCTGCCCGGCGAGGAAGCACGTCGAGCGGTGCGTGGACGACCCAGCGATGCTGATCGTGACGTACGAAGGCGAGCACGGCCACACCCAGCTGCCGGCGCAGCCTTCCACCCAGACG


Copyright © 2023 Grassius.org | Last updated: 2023-06-26