Tfome Clone Information

TFome Information for pUT5518

TFome Name pUT5518
Template DR817227
Genbank Insert ID KJ727611
Protein Name ZmMYB61
Species Maize
TF Family MYB
Gene ID GRMZM2G108959
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B285_F 3' Primer Name: B285_R
5' Primer Tm (º C): 73.4 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGCCACCGTGCT 3' Primer Sequence: GAACATGATGGGATCCGCA
PCR Condition: PCR Reaction Mix: 5 l GC buffer (NEB) 1 l primer f
Nucleotide Sequence: ATGGGGAGGCCACCGTGCTGCGACAACGGCGTCGGCGTCAAGAAAGGGCCGTGGACGCCCGAGGAGGACATCGTCCTCGTCTCCTACATCCAGCAGCACGGCCCCGGGAACTGGCGGTCCGTGCCAGAGAACACAGGGTTGATGAGGTGCAGCAAGAGCTGCAGGCTGCGGTGGACCAACTACCTGAGGCCTGGGATCAAGCGTGGAAACTTCACTCCTCATGAGGAAGGGATCATCATCCACCTCCAGGCGTTGCTTGGCAACAAGTGGGCAGCCATAGCCTCCTACCTCCCTCAAAGGACTGACAACGACATCAAGAACTACTGGAACACACACCTCAAGAAGAAGGTGAAGAGGCTGCAACAGCCGGCAGCCGACTCCTTCCAGACAACTGCCTCCAATGCAGTCACCTGCAGCCCAAACTACTACAGCCCCAGCAGCAGTCACCACAGCCTCCAAGGAATGCAGCCGATGAGCAGCTACCCCCACACCACCTGCAGCGGCGGAGCCCCAAGCAACAATGAGGCGATGACTGATACTACTACCGGCGTCGTCTCCAACCTCTTCCAGGCATGGATGAGGCCATCACCAGCAGCAGCGACAGCTAACTGCAAAATCGCCATGCAGGAGTTCCAGGAAGAACAAGGCGCTGCAGCAGCAGCCTCAATAGTCTGCAAGGAACAGATGGTGACCTGCGGTGATGTTAACAGGCCGCCGGCGCTGGAGATGGTGGTGGCGCCGGTGATGGGTGCGAGCACTGCCACCTTCTCGCTGCTCGAGGACTGGCTGCTCGATGACATGCCGGGGCAGGCCATGGATGGGTTCATGGGGATCTCCGCCGGTTGCTGTGCGGATCCCATCATGTTC
TFome clones do not contain stop codon at 3'end.
translation: MGRPPCCDNGVGVKKGPWTPEEDIVLVSYIQQHGPGNWRSVPENTGLMRCSKSCRLRWTNYLRPGIKRGNFTPHEEGIIIHLQALLGNKWAAIASYLPQRTDNDIKNYWNTHLKKKVKRLQQPAADSFQTTASNAVTCSPNYYSPSSSHHSLQGMQPMSSYPHTTCSGGAPSNNEAMTDTTTGVVSNLFQAWMRPSPAAATANCKIAMQEFQEEQGAAAAASIVCKEQMVTCGDVNRPPALEMVVAPVMGASTATFSLLEDWLLDDMPGQAMDGFMGISAGCCADPIMF