Tfome Clone Information

TFome Information for pUT5525

TFome Name pUT5525
Template BT067525.1
Genbank Insert ID KJ727614
Protein Name ZmMYB23
Species Maize
TF Family MYB
Gene ID GRMZM2G150841
transcript T01
Note c.G649A p.G217R Not present in template FLcDNA. Not present in functional domain.
Request Information: Deposited to ABRC
5' Primer Name: C147_F 3' Primer Name: C147_R
5' Primer Tm (º C): 65.1 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCGAGGCGGACGAG 3' Primer Sequence: ATTCAAGCACCAACTGCTGC
PCR Condition: PCR Reaction Mix:5 l GC buffer (NEB) 1 l primer fo
TFome clones do not contain stop codon at 3'end.