Tfome Clone Information

TFome Information for pUT5963

TFome Name pUT5963
Template Genomic DNA
Genbank Insert ID KJ727871
Protein Name ZmMYB123
Species Maize
TF Family MYB
Gene ID GRMZM2G172487
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: SE0067_F 3' Primer Name: SE0067_R
5' Primer Tm (º C): 61.7 3' Primer Tm (º C):
5' Primer Sequence: caccATGGAACAGGGGGACGATC 3' Primer Sequence: GCTAAAACAGCATGGACAGTGAGCA
PCR Condition: 5 l GC buffer 5 l 5x CES 1.5l MgCl2 50mM 1 l dNTPs
Nucleotide Sequence: ATGGAACAGGGGGACGATCATCGGAGGAAGATGGGCAGCAGGCCGCCATGGTGCGCGTGCGACAGGGCGGGGAATACGGCGGCGATGAAGAAGGGGCCATGGATGCCGGAGGAGGACCTCGTCCTCGTCTCCTACATCCACGAGCACGGCCCCACCAAGTGGCGCCACGTGCCCGCGAGCACGGGGCTGATGCGCTGCAGCAAGAGCTGCCGCCTCCGCTGGACCAACTACCTCCGCCCGGGCATCCGGCGCGGCAACTTCACGCCGCGCGAGGAGCGCGTCATCGTCCACCTCCACTCCCTGCTGGGCAACCGGTGGGCGGCCATCGCGTCGCATCTCCCGCAGCGCACCGACAACGACATCAAGAACTACTGGAACACCCACCTCAAGAAGAAGCTGGTCGTCGTCGAGGAACAGCACCGAGCGGCTGCGGCAGCAGCCATCGTCGCCGCCGCCGCTAGAGGACACGTCGACGACGACGGCGTCACCACCAGTAGTAGTCCCCGCCTGCTCGCCAAGGACGATAGCTACGGCTACGGCTACGACGCGCGCCCTGCTGCAGCCTATCCCTGTAGCATGGACAACGTATCCAAGCTTGTCAAAGTCAAAGCAGGTTGCATGAAGAGCGCATCATCGTCATCCCCGCCGGCGCAGGATGGTAGTAGTATCCGTCGTCCTTTCTTTTCACTCGACCAAACGTCCCGCAGTACGGCGCCGCTGCCACCCATCTCCAACGTGGTGCCGCAGCTAGCCGGTACGGTGTTGGCGGGACAGGGGCAGGGACGACACGGCGGGCGTTTCTTCCACGAGCCGCCCCAGCAGCAGCTGTCCTCAATAATGGAGAACTGGTTATTCCTCCCCAAGCACCAGCACCAGCAGCAGATGACGCAGAGCTCTCCGACTCCGACGGCTGCTGCTCACTGTCCATGCTGTTTTAGC
TFome clones do not contain stop codon at 3'end.
translation: MEQGDDHRRKMGSRPPWCACDRAGNTAAMKKGPWMPEEDLVLVSYIHEHGPTKWRHVPASTGLMRCSKSCRLRWTNYLRPGIRRGNFTPREERVIVHLHSLLGNRWAAIASHLPQRTDNDIKNYWNTHLKKKLVVVEEQHRAAAAAAIVAAAARGHVDDDGVTTSSSPRLLAKDDSYGYGYDARPAAAYPCSMDNVSKLVKVKAGCMKSASSSSPPAQDGSSIRRPFFSLDQTSRSTAPLPPISNVVPQLAGTVLAGQGQGRHGGRFFHEPPQQQLSSIMENWLFLPKHQHQQQMTQSSPTPTAAAHCPCCFS