Tfome Clone Information

TFome Information for pUT5974

TFome Name pUT5974
Template BT035749
Genbank Insert ID KJ727881
Protein Name ZmMYB83
Species Maize
TF Family MYB
Gene ID GRMZM2G024468
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B823_F 3' Primer Name: B823_R
5' Primer Tm (º C): 68.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGCCGCCGTG 3' Primer Sequence: AAAGAACTCGCACGGGTCCGCC
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGGGGAGGCCGCCGTGCTGTGAGAAGGCCGGGTTGAAGAAGGGGCCCTGGTCGCCGGAGGAGGACCTCTTGCTCGTCTCCTACGTGCAGGAGCACGGTCCTGGGAATTGGCGCGCCGTGCCATGCAGCACCGGTCTGATGCGCTGCAGCAAGAGCTGCCGGCTCCGGTGGACCAACTACCTCCGCCCGGGCATCAAGCGCGGCAGCTTCAGCGACCAGGAGGAGAAGCTCATCATCCACCTCCAGGAGCTGCTCGGGAACAAGTGGTCCGCGATTGCGTCGTACCTGCCGGAGCGGACGGACAATGACATCAAGAACTACTGGAACACGCACCTCAAGAAGAAGCTCGCCAAGACGGGCGCCAGGGAAAGCGGTGCCAGCGCCAAGACGACGAAGAAGAGCGATAGGGCCGCGGCGCCCAAGGGGCAGTGGGAGCGGCGGCTGCAGACGAACATCCACACCGCACGCCAGGCGCTCCGGGAGGCGCTGTCCATGGACGACACTGCGCCGCCGGCAATCAAGCCGGAGCCGCTGCCGCTGCCGCTGGGGCAGCTGCCGGCGCCAGCCAGCCAGGCGATGTACGCTTCCAGCATCGATAACATAGCGCGTCTGCTGGAGGGCTGGATGCGTCCCAGCGTCAGTGGGAATGCGTCGGCTGAGTCCATGTCCTCCTTCTCGGCGTTCTCCGGTGGTGGCGACGGCGCGTCGGCAAGCCACATCGGCACGGCGCACACGCCGGAGGGGTTCACCGGCACGAGAAAGGAAGAGGGCGCGGGGCCGGGGCCGGCGTCATTACCAATGTTCGAGAACTGGCTGCTCGATGACGGCATGGGGAACGGTGATGCGTCCCTCATCTGCGTCCCGCTGGCGGACCCGTGCGAGTTCTTT
TFome clones do not contain stop codon at 3'end.
translation: MGRPPCCEKAGLKKGPWSPEEDLLLVSYVQEHGPGNWRAVPCSTGLMRCSKSCRLRWTNYLRPGIKRGSFSDQEEKLIIHLQELLGNKWSAIASYLPERTDNDIKNYWNTHLKKKLAKTGARESGASAKTTKKSDRAAAPKGQWERRLQTNIHTARQALREALSMDDTAPPAIKPEPLPLPLGQLPAPASQAMYASSIDNIARLLEGWMRPSVSGNASAESMSSFSAFSGGGDGASASHIGTAHTPEGFTGTRKEEGAGPGPASLPMFENWLLDDGMGNGDASLICVPLADPCEFF