Tfome Clone Information

TFome Information for pUT5982

TFome Name pUT5982
Template BT035822
Genbank Insert ID KJ727889
Protein Name ZmOrphan194
Species Maize
TF Family Orphans
Gene ID GRMZM2G057529
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B910_F 3' Primer Name: B910_R
5' Primer Tm (º C): 71.4 3' Primer Tm (º C):
5' Primer Sequence: caccATGCTTCCCGATGATTGCTGCCA 3' Primer Sequence: TATCCATGATTCAATGGTGGATTTATAC
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGCTTCCCGATGATTGCTGCCACATCGTCGCTGAGGAAATTTCAAGCCCCATAGCTGCACATATACTCGACTTCTACTACGGCGACGGCCTGGGCGATGACCTCTTTGCCGCGGTGACTGCCACCTCTGGCCCATTCCCTGCCACTGACGATGATGTTTCTTCGTCTACCGCTACCACCCCTCCTATCTGCGGCTACAGTGAAGACACCGCAGCTGCTGGTGGAGCCACAGCCTACACCCCGTTGACATCCTTCGACACCACTCTCACAGCCCTCCTGGAGGAAGAGCAGCACCATGGCCTTGACGCCGGGTTCCTCCCGCAGATCGATGGCCTATCAGAGGTAGCAGCATACTATCCAACTGCCACCGATGAGGCCAGCATAGGGCAGTTCGACCAGATGGGACTTCCAGAGACCTTAGACGAGCAGGTGCCTCCTCCAGTGCAGATGAGCAGCAGTGCATCTGCCTTGATGCCGCTCGCTACAGACTATGATGAGTGCTTCATGGCAGCCGTAGCAGCTGGAGGGTTCATGGGTCTGGATGGAGCCATGTATCAGCAAACTGGAGCAGTTCTTCCAGGCTGCAGTGCAGATGCATCACAACAGGAATTCTTCAGCAGTGCCGGCAGCAACAGTATGGTGATGATTGGCGAGTATCAGAAGATGATGGAAGGTGAAGGGCTGACAACAACATATGACGACACAGATTCCATGCAAGGGACATTTAACACTAATGCAGAGATGCAGGTAGGAGGAAATAATCAGCACCTGATAAACGGATGCAACGGGAACCCAGCAACGTTACCTCCGACGGAACTATCAGTACTGGAAGACTCCACGTTTAAGGTCGTCCGCTTGTCGCCTGAAGAGAGAAAGGAAAAGATCCATAGGTACATAAAGAAACGGAACGAGAGAAATTTCCGCAAAAAAATAAAGTACGCATGTAGAAAAACCTTGGCGGATAGCAGGCCCCGTGTCCGTGGAAGGTTTGCCAAGAATGATGAACTCTGTGAAGCAGCGCAATCAGGCTCCCAGAGTCATGAACATTATGAACAAACTGACCATATGAAAGAAGAGGACATGCTGGACACATCTGACATTCTTGCGCAACTAAATGGATTAAACCCCTACAACTACAAGTATAAATCCACCATTGAATCATGGATA
TFome clones do not contain stop codon at 3'end.
translation: MLPDDCCHIVAEEISSPIAAHILDFYYGDGLGDDLFAAVTATSGPFPATDDDVSSSTATTPPICGYSEDTAAAGGATAYTPLTSFDTTLTALLEEEQHHGLDAGFLPQIDGLSEVAAYYPTATDEASIGQFDQMGLPETLDEQVPPPVQMSSSASALMPLATDYDECFMAAVAAGGFMGLDGAMYQQTGAVLPGCSADASQQEFFSSAGSNSMVMIGEYQKMMEGEGLTTTYDDTDSMQGTFNTNAEMQVGGNNQHLINGCNGNPATLPPTELSVLEDSTFKVVRLSPEERKEKIHRYIKKRNERNFRKKIKYACRKTLADSRPRVRGRFAKNDELCEAAQSGSQSHEHYEQTDHMKEEDMLDTSDILAQLNGLNPYNYKYKSTIESWI