Tfome Clone Information

TFome Information for pUT5985

TFome Name pUT5985
Template BT042134
Genbank Insert ID KJ727892
Protein Name ZmOrphan83
Species Maize
TF Family Orphans
Gene ID GRMZM2G006429
transcript T02
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B920_F 3' Primer Name: B920_R
5' Primer Tm (º C): 73.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCGTTCGCCGCCAGC 3' Primer Sequence: CTTCCCAACCAAGGCATCGAAAT
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGGCGTTCGCCGCCAGCGAGGGAAATCTTTCCCCGGCGCTGCCCCTGGCCACTCTGATCGGCCGCGAGCTCCGCGGCGACGGTACCGAGCGCCCGCACGTGCGCTACGGCCACTCTGGCTTCGCCAAGCGCGGCGAGGACTACTTCCTCGTCAAGCCCGACTGCCTCCGCGTCCCCGGAGACCCTTCCTCCTCTTTCTCCGTCTTCGCTGTATTCGACGGCCACAATGGCGTGTCGGCGGCGGTGTTCAGCAAGGAGAAATTGCTGGAGCACGTGATGAGCGCGGTGCCCGAGGGCATCAGTCGCGAGGACTGGCTACAGGCGCTGCCGCGCGCGCTCGTCGCAGGATTCGTCAAGACAGACATTGACTTCCAGCGCAAGGGTGAGACGTCAGGAACGACGGCGACACTTGTTGTGGTTGATGGGTTCACGGTCACTGTGGCGTCGGTGGGAGATTCTAGGTGCATTCTGGATACACAGGGAGGCGAGGTCTCATTGCTGACTGTGGATCACCGGCTAGAGGAGAATGCAGAGGAGCGTGAGCGCGTCACAGCGAGTGGAGGAGAGGTCAGCCGGCTTAATCTCTGTGGTGGACAGGAGGTGGGTCCTCTCCGATGCTGGCCAGGTGGATTGTGCCTTTCAAGGTCAATTGGGGATACTGATGTCGGCGAGTTCATTGTACCGATTCCACATGTCAAGCAAGTGAAGCTCCCAAATACTGGTGGAAGACTAATAATTGCATCAGATGGAATATGGGACGCTCTGTCCTCAGAGAGTGCTGCTCAGGCGTGCCGGGGATTACGTGCAGAACTGGCTGCAAAACTTGTTGTTAAGCAAGCTCTGAAGACAAGTGGGCTGAAAGATGACACCACATGTGTGGTTGTCGACATCATCCCATCTGATCATTGTTCAACACCACCAGCATTGTCTCCAAAGAAAAATCAGAACAAGTTGAAGCATCTTATTTTTGGTAAAAGGTCTCATAGTTCTGTTGGAAAGCTCAGCAAATCTGCTTCATTGGGTTCAGTGGAAGAAATATTCGAGGAGGGATCTGCAATGTTGGAAGAAAGTTGGATGTTCCAGTCCTGGTGTCCTGGGAATTCCATTCTATGTTCTCATTTCCTACACTGGCACAACCTGTTCTTTCATGGCATTGCCATTTTCCCTTTGTACTATTTCGATGCCTTGGTTGGGAAG
TFome clones do not contain stop codon at 3'end.
translation: MAFAASEGNLSPALPLATLIGRELRGDGTERPHVRYGHSGFAKRGEDYFLVKPDCLRVPGDPSSSFSVFAVFDGHNGVSAAVFSKEKLLEHVMSAVPEGISREDWLQALPRALVAGFVKTDIDFQRKGETSGTTATLVVVDGFTVTVASVGDSRCILDTQGGEVSLLTVDHRLEENAEERERVTASGGEVSRLNLCGGQEVGPLRCWPGGLCLSRSIGDTDVGEFIVPIPHVKQVKLPNTGGRLIIASDGIWDALSSESAAQACRGLRAELAAKLVVKQALKTSGLKDDTTCVVVDIIPSDHCSTPPALSPKKNQNKLKHLIFGKRSHSSVGKLSKSASLGSVEEIFEEGSAMLEESWMFQSWCPGNSILCSHFLHWHNLFFHGIAIFPLYYFDALVGK