Tfome Clone Information

TFome Information for pUT5986

TFome Name pUT5986
Template BT042372
Genbank Insert ID KJ727893
Protein Name ZmOrphan357
Species Maize
TF Family Orphans
Gene ID GRMZM5G833774
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B932_F 3' Primer Name: B932_R
5' Primer Tm (º C): 72.5 3' Primer Tm (º C):
5' Primer Sequence: caccATGCTGGCCGCGGTGATGG 3' Primer Sequence: GTAGGTGCTGTTCAGCCGTGCC
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGCTGGCCGCGGTGATGGACTATTTCAGCTCCTGCTGGGGCCCGCGATCGGGTGACGGGCACAGGGGGAAGGGCCCCGACGCCGCCGGCCGGCAGGACGGTCTCCTCTGGTACAAGGACGCCGGTCAGCTCGTCACTGGGGAGTTCTCCATGGCCGTGGTGCAGGCCAACCAGCTGCTTGAGGACCAGAGCCAAGTGGAGTCCGGATCGCTCTCCCTGGCTGACCCGGGCCCGCAGGGCACCTTCGTCGGCGTCTATGATGGCCATGGCGGTCCTGAGACGTCCCGGTTCATCAATGACCACCTCTTCAACCATCTCAGAAGGTTTGCAACTGAGCACAAGTTTATGTCAGCGGACGTGATCCGGAAAGCTTTCCAAGCAACTGAGGAGGGCTTTCTTTCTCTAGTCAGCAAGGAATGGTCTTTGAAGCCTCAGATTGCTTCAGTGGGCTCCTGCTGCCTTGTTGGTGTAATCTGTGCTGGGACTCTCTATGTTGCAAACCTGGGTGACTCACGTGCAGTTCTTGGAAGGCTTGTTAAGGCAACTGGAGAGGTCGTGGCCATGCAGTTGTCATCGGAGCACAATGCGTGCTATGAGGAAGTTAGACAAGAACTGCAGTCATCACATCCTGACGATCCACATATTGTGGTTCTCAAACACAATGTTTGGCGAGTGAAGGGTCTCATCCAGATCTCAAGATCTATTGGAGATGTATATCTAAAGAAACCAGAGTACAACAGAGAACCACTTCACAGCAAGTTTCGGCTTCGAGAAACCTTCCAGAGGCCGATCCTTAGTTCTGAACCTCAAATTACTGAACATCGAATACAGCCAAATGATCAATTTGTTATATTTGCTTCTGATGGTCTATGGGAGCACCTCAGCAATAAGGAAGCAGTTGACCTTGTCCAAAGTAGTCCACACAATGGAATTGCTCGGAGACTAGTGAAAGCGGCGATGCAAGAAGCTGCCAAGAAGAGGGAGATGAGATACTCAGACCTCAAGAAGATCGACCGTGGTGTGAGAAGGCATTTCCACGACGATATAACGGTCGTCGTGGTATTCCTTGATTTGAATGCCATGAGCAAAGCTAGCTGGAGCAAAAGCCCCTCGGTTTCTCTCCGAGGGGGCGGTGTCACCGTCCCTGCGAAGTCCCTCGCACCTTTCTCAGCTCCGGCACGGCTGAACAGCACCTAC
TFome clones do not contain stop codon at 3'end.
translation: MLAAVMDYFSSCWGPRSGDGHRGKGPDAAGRQDGLLWYKDAGQLVTGEFSMAVVQANQLLEDQSQVESGSLSLADPGPQGTFVGVYDGHGGPETSRFINDHLFNHLRRFATEHKFMSADVIRKAFQATEEGFLSLVSKEWSLKPQIASVGSCCLVGVICAGTLYVANLGDSRAVLGRLVKATGEVVAMQLSSEHNACYEEVRQELQSSHPDDPHIVVLKHNVWRVKGLIQISRSIGDVYLKKPEYNREPLHSKFRLRETFQRPILSSEPQITEHRIQPNDQFVIFASDGLWEHLSNKEAVDLVQSSPHNGIARRLVKAAMQEAAKKREMRYSDLKKIDRGVRRHFHDDITVVVVFLDLNAMSKASWSKSPSVSLRGGGVTVPAKSLAPFSAPARLNSTY