Tfome Clone Information

TFome Information for pUT5987

TFome Name pUT5987
Template BT067193
Genbank Insert ID KJ727894
Protein Name ZmOrphan42
Species Maize
TF Family Orphans
Gene ID AC208201.3_FG002
transcript T002
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B936_F 3' Primer Name: B936_R
5' Primer Tm (º C): 71.6 3' Primer Tm (º C):
5' Primer Sequence: caccATGTCTTGCACGGTGGCCATCC 3' Primer Sequence: CGAGCTTGAAAATTTCTGCAACTGC
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGTCTTGCACGGTGGCCATCCCGAGCTCGCCAGTCTTCTCGCCCTCACGCCGCCCACTCTCCTGCAAGGCCGCCTCCGCCTCACCGGAGCCCACCGTCCCCGCCTCTACCGCGGCGCCCGCGCCCGCCGCCGCCGCCGGCTCGCCGCTCCGCCCCTTCGCGCTCCGCGCGCTGCTGCGGGAGGAGGTCTCCCCGTCTCCGCCGCCCCAGCCGACCTCCGCCGCAGCGGTGGCTTTGGTACCGAGCGGGGCCGCGCTGAAGCGGCGGCGACCGACGCCGCTTGTCGTGCCGGCGTCCGGCGCCGCGGCAGCTGCTGCTGCGGCGGCGGCGGTGGCCGCTGTGGAGGCGGATCCGAGGAACGAGGTGGAGGAGGAAGGGGAGGAGTTCGCAGCGTACTGCCGGAGGGGAAAGGGAAGGAGAAGGGTGGAAATGGAGGACCGGCATGTGGCCAAGGTCGCTCTCGGCGGGGACCCCCAAGTGGCACTGTTTGGTGTGTTCGATGGCCACGGCGGGAAAAACGCGGCAGAGTTCGCCGCGGAGAACATGCCCAAGTTTATGGCCGAGGAGTTGACGAAGGTAAACGGCGGAGAGATCGAAGGAGCGGTGAAGAGGGGTTACCTCAAGACGGACGAGGAGTTCCTCAAGAGGGACGAGAGCGGGGGCGCGTGCTGCGTCACAGCCGTCCTCCAAAAGGGTGGACTGGTCGTCTCCAACGCTGGAGACTGCCGTGCGGTGCTCAGCCGAGCAGGGAAGGCAGAGGCGCTCACCTCTGACCACCGGGCGTCCAGGGAGGACGAGAAGGAAAGGATTGAGAATTTGGGTGGATTTGTGGTGAATTACCGTGGAACATGGCGAGTCCAGGGCTCCCTGGCAGTGTCTAGGGGCATTGGGGATGGACACCTAAAGCAGTGGGTTGTGGCTGACCCAGACACCACGACGCTCCTGGTTGACCAGCAGTGCGAGTTCTTGATACTTGCTTCTGATGGCCTCTGGGATAAGATCGACAATCAGGAGGCGGTAGACCTTGCACGACCTCTCTGCATCAACAATGACAAGACCTCTCGCATGGCTGCCTGCAGGATGCTCACCGAGACATCGATTTCCAGGGGCTCGACTGATGATATCAGTGTCGTGATCGTGCAGTTGCAGAAATTTTCAAGCTCG
TFome clones do not contain stop codon at 3'end.
translation: MSCTVAIPSSPVFSPSRRPLSCKAASASPEPTVPASTAAPAPAAAAGSPLRPFALRALLREEVSPSPPPQPTSAAAVALVPSGAALKRRRPTPLVVPASGAAAAAAAAAAVAAVEADPRNEVEEEGEEFAAYCRRGKGRRRVEMEDRHVAKVALGGDPQVALFGVFDGHGGKNAAEFAAENMPKFMAEELTKVNGGEIEGAVKRGYLKTDEEFLKRDESGGACCVTAVLQKGGLVVSNAGDCRAVLSRAGKAEALTSDHRASREDEKERIENLGGFVVNYRGTWRVQGSLAVSRGIGDGHLKQWVVADPDTTTLLVDQQCEFLILASDGLWDKIDNQEAVDLARPLCINNDKTSRMAACRMLTETSISRGSTDDISVVIVQLQKFSSS