Tfome Clone Information

TFome Information for pUT6015

TFome Name pUT6015
Template BT041314.1
Genbank Insert ID KJ727920
Protein Name ZmbZIP58
Species Maize
TF Family bZIP
Gene ID GRMZM2G149040
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B462_F 3' Primer Name: B462_R
5' Primer Tm (º C): 68.6 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCGATGCCACCGAA 3' Primer Sequence: GAAGGTGGTGTTGCTTTCACCCG
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGGCGATGCCACCGAAGCCCGGCGACCCGCCGCAGCGCTCGCCGGCACGTAGCCCAAACCTCAATCTCCCCTGCCCGCTGCCGCCGGTCCCGGGCGGGGCGCCGCCACCGCCGCAGCAGCAGCCGGGCGCCGGGCTGCCCCCGCCGCGCGTGGGCCACCACCGCCGCGCCAGATCTGAGGTGGCCTTCCGCTTCCCGGACGACCTGCCCGGCGGCGGGGGCGGCGGCTTCGACGAGATCGGCTCCGAGGACGACCTCTTCTCCACCTTCATGGACATGGACAAGATCGCCGGCGCCGACCGCGACCGCGCCGCCGAGACCTCCTCGCCGCCGCGCCCAGCCAAGCACCGCCACAGCGTCTCCTTTGACGGCTTCGGGATGGGGGCTGCCGCCGGCGGCCCGGGCGGCCAGCAGGACGGCGGTGGAGGCATGTTCGGAGAGGTGATGGAGGCCAAGAAGGCCATGTCTTCCGAGCAGCTCTCCGAGCTCGCCGCCATCGATCCCAAGCGCGCCAAAAGAATTATTGCAAACAGGCAATCTGCAGCACGGTCAAAGGAAAGAAAAGCTCGATATATAACAGAATTGGAGCGGAAGGTTCAAACTCTTCAGACAGAGGCTACTACTCTTTCAGCACAGCTGACACTATTCCAGAGAGACACAACTGGACTTTCAGCAGAAAATGCTGAGCTCAAGATAAGGTTGCAGGCCATGGAGCAGCAGGCCCAACTGCGTGACGCTCTAAATGATGCACTGAGGCAAGAAGTGGAGAGGCTTAAGATAGCAACGGGCGAGATGTCGAAGTCCAATAACGAGCATTTCAATATGGGAATGCAGCACGTTTCCTACAGCCCTTCATTCTTCCAGCTCTCGGAGCAACACACAGTGCAGCAGCATGGAAACATTCAGCTGCCGCACCATTTCCAACAGCCTCCGCTGAATGTCCCGAGCCACCAGATGCTATCCCACCCCAACTCCCTCTCGAACATGGTGCAGCAAGACTCTCTTGGGCGTCTCCAGGGGCTGGACATTGGGAAAGGCTCCATGGCTGTGAAGTCGGAGGCTGAGGTCGTGGTGAAGTCAGAGGGCAGCTCTATATCTGCGGGTGAAAGCAACACCACCTTC
TFome clones do not contain stop codon at 3'end.
translation: MAMPPKPGDPPQRSPARSPNLNLPCPLPPVPGGAPPPPQQQPGAGLPPPRVGHHRRARSEVAFRFPDDLPGGGGGGFDEIGSEDDLFSTFMDMDKIAGADRDRAAETSSPPRPAKHRHSVSFDGFGMGAAAGGPGGQQDGGGGMFGEVMEAKKAMSSEQLSELAAIDPKRAKRIIANRQSAARSKERKARYITELERKVQTLQTEATTLSAQLTLFQRDTTGLSAENAELKIRLQAMEQQAQLRDALNDALRQEVERLKIATGEMSKSNNEHFNMGMQHVSYSPSFFQLSEQHTVQQHGNIQLPHHFQQPPLNVPSHQMLSHPNSLSNMVQQDSLGRLQGLDIGKGSMAVKSEAEVVVKSEGSSISAGESNTTF