Tfome Clone Information

TFome Information for pUT6095

TFome Name pUT6095
Template RT-PCR
Genbank Insert ID KJ727980
Protein Name ZmTUB8
Species Maize
TF Family TUB
Gene ID GRMZM2G472945
transcript T02
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: R152F 3' Primer Name: R152R
5' Primer Tm (º C): 64.9 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCGACCGTCCCAAACC 3' Primer Sequence: CAGGGTGCAGCACAACTTCGC
PCR Condition:
Nucleotide Sequence: ATGGCGACCGTCCCAAACCCCAAGACGACCAGGGCCAGGAGGGAGCCGGCGCTGCGTCCCCGAAGCAACAACGTCGCGGCGGCTCCGGCTCCGGCTCCGGCCGTGGCGAGCGTCAGGCGCGGGCCGGCGGCATCCGCCGAGAAGGAGAACCAGCCGCCCAAGAGCCTCGGCCACGGGAAGGCGGCGGCTGCGGCGACGGCCGCCGAGCCGCCGAAGCCCGCGGAGCCGGCGCCGGTTGTAGCGCCACCTCCGCCGCCGCTGAGGCCGTCGTCGCTGCAGCTCCGCATGAAGGACGAGGCGGCGGCGGCGGCGCTGCCCGCGTTCGTCGTCGGGCCCAGGGGCAGGGAGCTGCTCCCGCCGCCGTCCTCCAACTACGAGGCGTGGGACCTCTCCGACAGCGAGTCCGCGCCGGCCTCCTCCTGGGCCACGCTCCCCAACAGGGCGCTGCTGTGCCGGCCTCTGCCTCAGGACGTCGGACGGTGCACGTGCGTCATCGCCAGGGAGGCGGCCACCGGCGCCAGAGGCGTCGCGCTCTACTCCCTCTATACCAATGAGGGGCAGGGGCGGCAGGACCGCAAGCTGGCGGTGGCGCGGCACCGGAGGAGGAGGGGCAGGTCCGAGTTCGTCGTGGCGCAGAACCAGGACGGCATCTTCTGCACCGCCGACACCAGCTTCCTCGGCGCGGTGCGCGCCAACCTGGTCGGATCCAAGTACCGAATCTGGGGCCAGGGTGACGAGCTCAAGAACCAGTCGAAGCGGCTCCTTGCCGTTGTCGCGTTTGCCCCCACCATCACCACGCTCACCGGGAGTTTCAGGAGCTTGAGGGCATGGATCCCCAAGAACCAGTCCATGCAGCTCAAGGCAAACAGTTCTGCTCAGATCCAGCATGTCAGTGGGCTCCCAAAGGATTGGCAGGAGAAGAAGAGCAGAGCTGACCAGTTGTGCTCAAGAGCCCCGTTCTACAACCATATGACAAAGCGCTACGAACTGGACTTCAGAGAAAGGGCAGGAAGGATGGGGTACAAGGTGCAAACATCGGTCAAGAATTTTCAGATGACTTTGGAGGAAAATGGGAGGCAGACGGTGTTGCAGCTTGGTAGGGTTGGCAAATCCAAGTACATAATGGACTTTAGATACCCGCTGACCGGCTACCAAGCGTTCTGCATCTGCCTGGCATCGATCGACGCGAAGTTGTGCTGCACCCTG
TFome clones do not contain stop codon at 3'end.
translation: MATVPNPKTTRARREPALRPRSNNVAAAPAPAPAVASVRRGPAASAEKENQPPKSLGHGKAAAAATAAEPPKPAEPAPVVAPPPPPLRPSSLQLRMKDEAAAAALPAFVVGPRGRELLPPPSSNYEAWDLSDSESAPASSWATLPNRALLCRPLPQDVGRCTCVIAREAATGARGVALYSLYTNEGQGRQDRKLAVARHRRRRGRSEFVVAQNQDGIFCTADTSFLGAVRANLVGSKYRIWGQGDELKNQSKRLLAVVAFAPTITTLTGSFRSLRAWIPKNQSMQLKANSSAQIQHVSGLPKDWQEKKSRADQLCSRAPFYNHMTKRYELDFRERAGRMGYKVQTSVKNFQMTLEENGRQTVLQLGRVGKSKYIMDFRYPLTGYQAFCICLASIDAKLCCTL