Tfome Clone Information

TFome Information for pUT6271

TFome Name pUT6271
Template Synthesized template
Genbank Insert ID KJ728105
Protein Name ZmMYB12
Species Maize
TF Family MYB
Gene ID GRMZM2G104789
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 3' Primer Tm (º C):
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGGGCAGGGCCCCATGCTGCGATAAGGCTACTGTTAAGAAGGGCCCCTGGTCCCCAGAGGAGGACGCTAAGCTGAAGTCCTACATCGAGCAGAACGGCACCGGCGGCAACTGGATTGCTCTGCCACAGAAGATCGGCCTGAAGAGGTGCGGCAAGTCTTGCAGGCTTCGCTGGCTGAACTACCTGAGGCCGAACATTAAGCACGGCGGCTTCTCTGACGAGGAGGACATGATCATCCTGAGCCTGTACATCAGCATCGGCTCCAGGTGGTCCATCATTGCCGCTCAACTTCCAGGCAGGACCGACAACGACATCAAGAACTACTGGAACACCAGGCTGAAGAAGAAGCTGTTCGGCAAGCAGAGCCGCAACAAGGACCAGAGGCAGCAGCACCAGTTCATGAGGCAGCTTGCTGGCAGCGCTGCTTCTGACGGCATGGTGAAGCAAGAGGCTGCTGCTGGCGGGGATGCTGATGCAGCTGCTGCAGGCTCATCATCTGTGGCTGTGGCCGCTACCTACAACTGGCACCACCACGCTATGGCCATGGCTATGCCAGTGCAACCAGTGCCAGGCAGCACCACTATCATGGAGGGCCATAGGGCTGAGGCTGACGAGGTGGACGAGTCTATTAGGAAGCTGCTGTACAAGCTTGGCGGCGCTGCTGGCCCATCTACTGCTCTTAGCTCTGTGCCACAGTGCGTGAGGCCGATGTACGAGGAGAGGTCTGCTGCTAGCCTGATGCCTCCTCCGCCACCACCACCATCTTGCCCAGCTGTGGTGGACGCTAGCAGCTCTGCTTCTCTTGATGAGGGCGGCGGCGTTCTGCCAGCTCTTGAGCTTGATCAGAGCTTCCACTTCGGCCAGGTGAAGCTGGATGGCCTCGAGAGCTTCTTCGGCATGGGCGGCCAATCTGGCATGAGGTGGTGGTCTGAGGCTAGCCCACTGGTGTGCCCATCTTCTACTGTGGCCGCTGCTAGCTCTAGCAGCCACGGCATGCAGATGCAGCAGTACTGCGTGGTGGTTGACGAGCCAGGCAAGCTGGGCATGAAC
TFome clones do not contain stop codon at 3'end.
translation: MGRAPCCDKATVKKGPWSPEEDAKLKSYIEQNGTGGNWIALPQKIGLKRCGKSCRLRWLNYLRPNIKHGGFSDEEDMIILSLYISIGSRWSIIAAQLPGRTDNDIKNYWNTRLKKKLFGKQSRNKDQRQQHQFMRQLAGSAASDGMVKQEAAAGGDADAAAAGSSSVAVAATYNWHHHAMAMAMPVQPVPGSTTIMEGHRAEADEVDESIRKLLYKLGGAAGPSTALSSVPQCVRPMYEERSAASLMPPPPPPPSCPAVVDASSSASLDEGGGVLPALELDQSFHFGQVKLDGLESFFGMGGQSGMRWWSEASPLVCPSSTVAAASSSSHGMQMQQYCVVVDEPGKLGMN