Tfome Clone Information

TFome Information for pUT6438

TFome Name pUT6438
Template Synthesized template
Genbank Insert ID KJ728168
Protein Name ZmMYB45
Species Maize
TF Family MYB
Gene ID GRMZM2G051793
transcript T01
Vector pENTR/SD/D-TOPO
Note Synthesized with a stop codon
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 3' Primer Tm (º C):
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGGATTGGTACTCTGATGATTCTGATCCAGATATCGATGAGGACTTGAGAGAAGATTTGGATGCTTTGAGAAGATCTTGCATCTTGTCTGGTGCTGATCCAGATGCTGCTGTTGCTCAAGTTTCTTCTGGTTTGGCTGGTCCATCTACCCCAGCTTTGGCTGCTGCTCCAGGCGCTGCTGCTGATCATCATCACCATGCCTCTTCATCTGATGATGAAGAAGATGAAGATTTGGCCTTGGTTAGATCTATCAGAGCTAACTTGCATCACTTGCATAACTCTAAGGCTTCTACCGTTTTGCCAGATGCTGCCCCAGCTCCAAGAGATGATGATGATCCATCTTCTAGACCAATCTGCACCTGGCCACCATCTGATACCGATGAAGAGGAAGATGATTTGGAAACCTTGAGAGCTATCCAAAGAAGATTCTCTCACTACCAATCTTCTACCTCTACCGCTTCTCCAAAGACCATGAAGCCAGAGGCTTCTCAAGGTGTTCATTCTGATTTGTTCGCTGATAGATCTGGTGATGATTTCGCTGTTCAAAAGCAAAACGCTATCGTTCCACATGGTGATGGTTTCCCAAAGGCTGCTTTGTTGTTGGTTGATGCCTTGAAGAAGAACAGAGCTTACCAGAAGTTCATTAGAAGAAAGATGGTTAACATCGAGGCCAAGATCGAAGAAAACAAGGATTTGAGAGATAGGGTCAAGTGCTTGTTGGGTTACCAATTGTCTTGCAGAAAGTCTGTTTCTAGATCTTTGGGCCAAAAGGAAGATCCAAGAGTTAGATTGATCTCTCCATTGAAGTCTACCCAACCATGCACCAAGAACAAGTACAGAAAGATCCCAGCTTTGTTCTTGGGTCCAGCTGAAAACCCACATGTTTCTAAGTACGAAATGGCCTTGAAGCAATTCCCAATGTCTTTCAAGAAGCAACCTTGGTCTGACGCTGAAAAGGATAAGTTGGCTAGAGGTATCAAGCAACAATACCAAGAAACCTTGATCTTGGACTCTTTGAACAACGGTTCTGCTGATGGTGATTTCTCTGCTTTGGATATGGCTTACGCTTTGACCAACGGTGCTGGTAACTTCGAGGTTACCCCAGAAAACTTGAGATCTGTTTTGCCATTGATCAACTGGGATAAGATCTCTGCTATGTACTTGCCAGGCAGATCTGGTGCTGAATGCGAATCTAGATGGTTGAACTGCGACGATCCATTGATTAACCATGAAGCTTGGACCGCTGATGAAGAAACCAGATTGCTTTTGATCATCCAAGAAAAGGGCATGTGCAACTGGATCGATATCGCTGTTACCTTGGGCACCTACAGAACCCCATTCCAATGCTTGGTTAGATACCAAAGATCCTTGAACCCACACATCTTGAACAAGGCTTGGACCAAGGAAGAGGATCTTCAATTGCAAGCTGCTGTTGAAACCTTCGGTCAAAAGTGGCAATTGGTTTCTGCTTCTTTGGATGGTAGAACCGGTACTCAATGCTCTAACAGGTGGAGAAAGACCTTGCATCCAGAAAAGACCTCTGTTGGTAGATGGTTGTTGGATGAAGATAAGAGATTGATGGTTACCGTTAAGTTGATCGGTCCAGGCAGATGGTCTTTGATCGCTCCATTCATCCCAGGTAGAACCCAAACCCAAATCTTCGAAAGATGGTGCAACATCTTGGATCCAGACTTGTACTTGGATGATTGGAGGCCAGATGAAGATTCTACCTTGTTGGCTGCTGTTTCTGAATTCGGTCCATGCTGGTCTAAGATCTCTAAGACCATCATTCCAGGTAGAAACGATTCTATGTGCTATAGAAGGTGGAGAAAGTTGTGCAAGCACGAAGTTCAAAAGGCTAGAGAAGCTAGACAATTGAAGAAGGCTATCTTCCAAAACAACTTCGTTGACAGAGAAAAGGAAAGACCAGCTATCTGCCCAAGAGATTTGATTTCTTTGTTGCCATCTAAGGGTGATGGTTGCGACGTTGCCATCGTTAGATACTGCAAGTTCTTGTGCTCCTCCTGCATCTTGATCTCATTGGGCGGTTCTGAAAAGCAAGGTGAAGAAAACCATTTGGCCTTGTCCAATATCGTTAACATCTCTTCTGGCTTGGATTGCGTTGCCGCTAACTCTGTTTTGAACGCTTCTTCTAGAAGGCCAAGAAGAGTTTCTTCCGGTAGAAGATCTAAGAAGCACACCGAAGGTAACAACATTGCTGCTCCAGATGATTTGAACGCCTCTTCCTCTGCTCCATCATCTTCTATCAAGAGAAAGTCTACCACCGGTAACAATGTTGCTGCTAAGAAGAGATCTAGAGTTTCCATCTCTGTTAACGCTGATAACGAAGTTGAGAAGAACAGAATCACCGATTCTGTTGCCGTTTCTGAAGAAGGTTTGGTTAAGAAGAGAACCAGAAGGCCAAAGCCAGTTGGTAACGAAGGTGCTGTTAGAAAGAGAGGCGGTTCTAACAACGAAGTTGGCACCAACATCATCACTGAATCTGTTGCTGTTGGCGAAGAGGGTGTTGTCAAGAAGAGGACTAGAAGATCCAAGCCAGTCGGCAACGAGGGTGCCGATAATGAAGTTGGTACTTACAGAATTACCGGCTCTGTTGTTGTTGGTGAGGAAGGTGTCGTTAAGAAGCGTACAAGAAGATCTTCCAAGCCTGTTGATAACGAAGAGGTTGTCAGAAAGATGAGAGGCTCTATCAACAACTACGATGAAGCTGGCACTAACACCATGATGAACTCTGCTTTCGGTGAAGAAGAAGTCGTCAAGAAGAAGACCAGACATTCTAAGCCTGTTGGTACTGAAGGCGCTGCTTCTATCGGTGGTGATGGTATGGTTAACAAGAGAAGAACTGGTTCTGTTTCTACCGAAAACTTGGGTGCCGTCAGAAAGAGAAAGATCGTTTCTTCCAGAAGAAAGTTGGCTGAAGTTAACTTGCCAACCGAAGAAGGTGTTCCAAACGCTGTTCCAGATTTGGATTTCCCATGCGCTATCTCTGAAGAAAGAGCTGTTGACGTTGGTAACATGGATAAGGGTAGAAGAAAGTCTACTCCAAGACCAAAGCAAATCAACATGCCAGAGGAAGATGCTGATAAGAACTCTACCTTCACCAGATTGGTTAACTGCTTGTCTTTCGCTAGAATGAAGGGTATCGATAGAAACAAGAGGTGA
TFome clones do not contain stop codon at 3'end.
translation: MDWYSDDSDPDIDEDLREDLDALRRSCILSGADPDAAVAQVSSGLAGPSTPALAAAPGAAADHHHHASSSDDEEDEDLALVRSIRANLHHLHNSKASTVLPDAAPAPRDDDDPSSRPICTWPPSDTDEEEDDLETLRAIQRRFSHYQSSTSTASPKTMKPEASQGVHSDLFADRSGDDFAVQKQNAIVPHGDGFPKAALLLVDALKKNRAYQKFIRRKMVNIEAKIEENKDLRDRVKCLLGYQLSCRKSVSRSLGQKEDPRVRLISPLKSTQPCTKNKYRKIPALFLGPAENPHVSKYEMALKQFPMSFKKQPWSDAEKDKLARGIKQQYQETLILDSLNNGSADGDFSALDMAYALTNGAGNFEVTPENLRSVLPLINWDKISAMYLPGRSGAECESRWLNCDDPLINHEAWTADEETRLLLIIQEKGMCNWIDIAVTLGTYRTPFQCLVRYQRSLNPHILNKAWTKEEDLQLQAAVETFGQKWQLVSASLDGRTGTQCSNRWRKTLHPEKTSVGRWLLDEDKRLMVTVKLIGPGRWSLIAPFIPGRTQTQIFERWCNILDPDLYLDDWRPDEDSTLLAAVSEFGPCWSKISKTIIPGRNDSMCYRRWRKLCKHEVQKAREARQLKKAIFQNNFVDREKERPAICPRDLISLLPSKGDGCDVAIVRYCKFLCSSCILISLGGSEKQGEENHLALSNIVNISSGLDCVAANSVLNASSRRPRRVSSGRRSKKHTEGNNIAAPDDLNASSSAPSSSIKRKSTTGNNVAAKKRSRVSISVNADNEVEKNRITDSVAVSEEGLVKKRTRRPKPVGNEGAVRKRGGSNNEVGTNIITESVAVGEEGVVKKRTRRSKPVGNEGADNEVGTYRITGSVVVGEEGVVKKRTRRSSKPVDNEEVVRKMRGSINNYDEAGTNTMMNSAFGEEEVVKKKTRHSKPVGTEGAASIGGDGMVNKRRTGSVSTENLGAVRKRKIVSSRRKLAEVNLPTEEGVPNAVPDLDFPCAISEERAVDVGNMDKGRRKSTPRPKQINMPEEDADKNSTFTRLVNCLSFARMKGIDRNKR*