Tfome Clone Information

TFome Information for pUT6477

TFome Name pUT6477
Template BT064296
Genbank Insert ID KJ728201
Protein Name ZmOrphan214
Species Maize
TF Family Orphans
Gene ID GRMZM2G052699
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C528_F 3' Primer Name: C528_R
5' Primer Tm (º C): 71.3 3' Primer Tm (º C):
5' Primer Sequence: caccATGTCTTCGCGCTCGGGGTC 3' Primer Sequence: CCCACTGTTTCTTGATGAATCTCG
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGTCTTCGCGCTCGGGGTCCACGGGCGGAGGGAGCACCGGCGGCGGCAGCAGCGCGGGGGGAGGCGGCGCGGTGCCGCTGGCCGTGCTGCTCAGGCGGGAGGTGGCCAGCGAGCGCACCGCGTCGGAGCGCCCGGAGCTGCACTGGGGCCTCTTCAGCCAGGCCAAGAAGGGCGAGGACTTCACCTTCCTCAAGCCCGAATGCGAGCGCGTCCCTGACGTCCCGTCCTCCTCCTTCTCCGCCTTCGGCCTGTTTGATGGGCATAATGGGAACGGAGCCGCAATTTACACCAAGGAGAATCTCTTGAACAACATCTTGAGTGCGGTCCCAGCCGATCTGAACAGGGAAGACTGGCTTGCTGCACTCCCAAGAGCGCTGGTTGCTGCATTCGTCAAAACCGATAAGGATTTCCAGACTAAAGCACGTTCTTCAGGGACAACTGTGACATTTGTCATAATAGATGGATTGGTCATCACTGTTGCATCAGTTGGTGATTCCCGTTGTGTACTACAAGCTGAAGGTTCAATTTATCATCTATCCTCTGATCATCGGTTCGATGCAAGCAAAGAGGAGGTTGATCGTGTAACAGAATGCGGAGGTGATGTTGGAAGGCTAAATGTTGTTGGTGGTGCTGAGATTGGCCCCCTTAGATGTTGGCCTGGAGGTTTGTGCCTATCAAGGTCAATTGGAGATCAAGATGTTGGTGAATTTATCGTTCCAGTTCCTCTTGTGAAGCAAGTTAAGCTATCTACTGCGGGTGGCCGACTCATTATTGCAAGTGATGGTGTTTGGGATGTCTTGTCTCCAGAAGTAGCTTTTAACTGTTCACGTGAACTTCCTCCAGTGCCTGCAGCTGAGCAAATCGTTAAAACTGCTGTGCAATCAAAAGGGCTGAGGGATGATACCACCTGTATTGTTGTTGATATAATAGTAGAAAAAAACAACTCTTCCATGCCACTTGCTAAAAGGCAACCAGGAATTGGTGTCTTCAAAAATATGTTCGGCAAGAAAAAATCATCGGATTCATCATCCCATTCCCATTCAGATAGAGAATATATGGATCCAGATAACGTGGAGGAAATATTTGAGGATGGGTGTGCGCTTCTTTCTAGACGGCTGGATTCTGAATACCCTGTTCGAAATATGTTCAAACTGTTCATATGTGCCATTTGTCAAGTAGAGTTAAAGCCAAACCAAGGTATATCTGTACATGAAGATTCATCACAACCTGGGAGCTTGCGTCGCTGGGATGGTCCATTCCTTTGCCAGAGCTGTCAGGAAAAGAAAGAAGCAATGGAGGGAAAGCGTCGTTCACGAGATTCATCAAGAAACAGTGGG
TFome clones do not contain stop codon at 3'end.
translation: MSSRSGSTGGGSTGGGSSAGGGGAVPLAVLLRREVASERTASERPELHWGLFSQAKKGEDFTFLKPECERVPDVPSSSFSAFGLFDGHNGNGAAIYTKENLLNNILSAVPADLNREDWLAALPRALVAAFVKTDKDFQTKARSSGTTVTFVIIDGLVITVASVGDSRCVLQAEGSIYHLSSDHRFDASKEEVDRVTECGGDVGRLNVVGGAEIGPLRCWPGGLCLSRSIGDQDVGEFIVPVPLVKQVKLSTAGGRLIIASDGVWDVLSPEVAFNCSRELPPVPAAEQIVKTAVQSKGLRDDTTCIVVDIIVEKNNSSMPLAKRQPGIGVFKNMFGKKKSSDSSSHSHSDREYMDPDNVEEIFEDGCALLSRRLDSEYPVRNMFKLFICAICQVELKPNQGISVHEDSSQPGSLRRWDGPFLCQSCQEKKEAMEGKRRSRDSSRNSG