Tfome Clone Information

TFome Information for pUT6478

TFome Name pUT6478
Template BT061518
Genbank Insert ID KJ728202
Protein Name ZmOrphan242
Species Maize
TF Family Orphans
Gene ID GRMZM2G058573
transcript T02
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B922_F 3' Primer Name: B922_R
5' Primer Tm (º C): 67.8 3' Primer Tm (º C):
5' Primer Sequence: caccATGTCATTGGGCTATGCTGAGAAG 3' Primer Sequence: GCAGTTCAGCTTCTTGTCTTTCA
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGTCATTGGGCTATGCTGAGAAGCTGTCCTACCGGGAGGATGTGGGTACTGTGGGAATGCCTGAGATCTTTGAGACCCCTGAGCTAGTCCAGAATAAGATAGAAGAGCTTGCTGCCATGGTGCAAAAGAGTAAGCATTTAGTGGTGTTTACCGGGGCAGGGATATCAACTTCATCAGGCATACCTGATTTTCGAGGGCCCATGGGTGTCTGGACCTTGCAGCGTGCAGGAAAAGGTATTCCTAATGCATCACTTCCCTTCCATCATGCTGTTCCAAGCTTGACACATATGGCACTAGTCGAACTTGAAAGAGCAGGATTTCTAAAGTTTGTCATAAGCCAGAATGTTGACAGCCTACATCTCCGTTCTGGTTTCCCAAGGGAGAAGTTGGCTGAATTACATGGCAATTCTTTCAAGGAGATCTGCCCATGCTGTAAAACTGAGTACCTTCGTGATTTTGAGATTGAGACAATTGGACTGAAGGATACTCCAAGACGTTGTTCTGATAAGAATTGTGGAGCTAGATTAAAGGATACAGTTCTTGACTGGGATGATGCTTTACCCCCTGAGGAGATGAATTTGGCCACGGAGCATTGTCGATCAGCTGATCTTGTTCTATGTCTAGGAACTAGTTTGCAGATTACTCCTGCATGTAATATGCCTCTGATGTCAATCAAGAATGGGGGGAGGGTGGCCATTGTAAATCTTCAGGCAACTCCAAAGGATAAAAAGGCAAGCCTTGTCATCCATGGACTTGTTGATAAGGTCATTGCTGGAGTCATGAGCAAGTTGAGTCTGCGAATTCCTCCATACATACGTACTGACTTTGTTCAGCTCACTCTCAGGCACTCACTGAAAAAGAAATGTGTTAGATGGACTCTTCGAGTAACAAGTATTCATGGCCTCCGAGCACCATTGCCATTTCTTCAGTCTGTCAAGGTTTCCTTTCCAGAAAGACCTGATCTGAAGTCTGTAGTGCTTAAAGAGCAACCATTCTCTTTGCAGAGGGAAACATCGATGAACAAACCATTTTTCATGCTGTTGACATTAAATTTCAGTGATGGTTGCAGCTGTTTGAGCTCCTCAATTGGATGGCCTGTTGATTTTCAGAAGCGAAAAGACAGCTTCGTCAGAGATAGAGCTCTAGTCCTACGGGAGTTGTACTCTGCTGCACAGCGCGAGTCTTGCATTGGGCAACAAGAAATTCTGGAAAGAGAGAACCTACCAAGAGCTGAGACGTCTATTCATGGAATCGTGACAAACATCGTTAGGTATGACACTGAAGATGAAAAGTTGGCTCCACCCAAGAATGATTTGATGAATCACAGCCGCAGCAACCCTGCAAAACGGCACGTGGAAGGCACTGATTGCCACTCGTCATTGCCAAAGAAACTGAAGTACTTTTTGAAAGACAAGAAGCTGAACTGC
TFome clones do not contain stop codon at 3'end.
translation: MSLGYAEKLSYREDVGTVGMPEIFETPELVQNKIEELAAMVQKSKHLVVFTGAGISTSSGIPDFRGPMGVWTLQRAGKGIPNASLPFHHAVPSLTHMALVELERAGFLKFVISQNVDSLHLRSGFPREKLAELHGNSFKEICPCCKTEYLRDFEIETIGLKDTPRRCSDKNCGARLKDTVLDWDDALPPEEMNLATEHCRSADLVLCLGTSLQITPACNMPLMSIKNGGRVAIVNLQATPKDKKASLVIHGLVDKVIAGVMSKLSLRIPPYIRTDFVQLTLRHSLKKKCVRWTLRVTSIHGLRAPLPFLQSVKVSFPERPDLKSVVLKEQPFSLQRETSMNKPFFMLLTLNFSDGCSCLSSSIGWPVDFQKRKDSFVRDRALVLRELYSAAQRESCIGQQEILERENLPRAETSIHGIVTNIVRYDTEDEKLAPPKNDLMNHSRSNPAKRHVEGTDCHSSLPKKLKYFLKDKKLNC