Tfome Clone Information

TFome Information for pUT6487

TFome Name pUT6487
Template BT038466.1
Genbank Insert ID KJ728210
Protein Name ZmMYB30
Species Maize
TF Family MYB
Gene ID GRMZM2G171781
transcript T01
Vector pENTR/SD/D-TOPO
Note c.A371G p.N124S; c.T627C p.H209(=); c.G726A p.A242(=); c.C1009A p.P337T PZE08127729220 c.T1056A p.V352(=) PZE08127729267 c.G1092A p.T364(=); c.A1160G p.N387S PZE08127729371 c.A1164C p.I388(=) present in template FlcDNA. None present in Myb-domains.
Request Information: Deposited to ABRC
5' Primer Name: B305_F 3' Primer Name: B305_R
5' Primer Tm (º C): 72.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGCATTCTTGCTGCTACA 3' Primer Sequence: GATATTCTCAAAAGATAGTTGCATTCTTT
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGGGAGGCATTCTTGCTGCTACAAGCAGAAGCTGAGAAAGGGGCTCTGGTCCCCTGAGGAGGATGAGAAACTCATGAATCACATAACAAAGCATGGCCATGGCTGCTGGAGCTCTGTTCCCAAACTCGCTGGGCTTCAAAGGTGCGGAAAGAGTTGTAGGCTGAGGTGGATAAACTATCTGAGGCCAGACCTCAAGAGAGGGGCATTCGCCCAAGACGAAGAAGACCTCATCATCGAGCTGCACGCTGTCCTCGGGAACAGGTGGTCTCAAATTGCAGCGCAGCTGCCAGGGAGGACTGATAATGAGATCAAGAATCTATGGAACTCGTGCATCAAGAAGAAGCTGAGGCAGAAAGGCATTGATCCCAGCACCCACAAGCCACTTACTGAGGCTGATCGCGGCGGTGCAGCTCCCACCATCAGCACCGAGAGAACCTCAGGGTCCAGCGACGTCAACCCATCAAGCACTGGTCCTCTGGGGAACTTGAGCCCCCTCCTCAGCGAGACGGCTCAATCATCAATGCTGATGCCCGTGTACGACAAGAATCGTGCTGAAACACCAAACTTGGCACGCCCTAAGCTGCCACCAAAGGAGCTGTTCCTGGAGCAGCTTACTGCTGGACACGAGAGTCCATCAACCTGCCACTCATCAGGCCAAACTCTCTATTTCCCTTTCCAACAGCCTTTAGGCTACAACAGTGAGAGTGGCAGCAGCGATGGGGCAAATATGAATTCACTCTGGTTCAACCAGAGTGACTTCAACTGCAGCACAATTTCTACAGTGATGCCGCCAGTTTCACCATCGGCCCTCTCTACATCAATGGGGCTGAATCTTCCACCTGATAATCCTCGACATGGAGGAACTGGCATTGGAAGTACCGCAGTAGATTCATTCTACTGGGATGGTACTAATCCTAGCAGCAGTAGCAGTACTGGGAGCAGAGGGAGCAACAGTATGGGATTTGAACCACAGAGCACGAGCACAATTCTGGAGAACAGTGTCTTCACATGGACAGACATTGGACAAGAAAAAGATACAAGGGCTCACCTAGTAGCGGAACTTAAGTGGCCTGACTCCTTTGCCGAGACAACCACAGCCATGCAGAACCAGAGCCAAACGCTTTATGATGATGTGATCAAGGCAGAGAGCCAATTCAGCATCGAAGGGATATGTGCTTCTTGGTTCCAGAATCAGCAGCCACAGCAACAGCTGCAGGTAGCACCAGACATGTATGACAAGGACTTGCAAAGAATGCAACTATCTTTTGAGAATATC
TFome clones do not contain stop codon at 3'end.
translation: MGRHSCCYKQKLRKGLWSPEEDEKLMNHITKHGHGCWSSVPKLAGLQRCGKSCRLRWINYLRPDLKRGAFAQDEEDLIIELHAVLGNRWSQIAAQLPGRTDNEIKNLWNSCIKKKLRQKGIDPSTHKPLTEADRGGAAPTISTERTSGSSDVNPSSTGPLGNLSPLLSETAQSSMLMPVYDKNRAETPNLARPKLPPKELFLEQLTAGHESPSTCHSSGQTLYFPFQQPLGYNSESGSSDGANMNSLWFNQSDFNCSTISTVMPPVSPSALSTSMGLNLPPDNPRHGGTGIGSTAVDSFYWDGTNPSSSSSTGSRGSNSMGFEPQSTSTILENSVFTWTDIGQEKDTRAHLVAELKWPDSFAETTTAMQNQSQTLYDDVIKAESQFSIEGICASWFQNQQPQQQLQVAPDMYDKDLQRMQLSFENI