Tfome Clone Information

TFome Information for pUT6496

TFome Name pUT6496
Template BT040338
Genbank Insert ID KJ728219
Protein Name ZmOrphan250
Species Maize
TF Family Orphans
Gene ID GRMZM2G412937
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C515_F 3' Primer Name: C515_R
5' Primer Tm (º C): 71.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGGTTTACGATGGCGCCGTGAAG 3' Primer Sequence: GAGACGAGGCGAGGAAGGGGAA
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGGTTTACGATGGCGCCGTGAAGGACCAGGACCAGGAGACCGTGGCGGCGAGCACTGCATCGGCGGCATCGGTGGTGGCGGTGTCGGAGGCGTCTCCCGCGCCGGTGGTGGTGGTGGTCAGTGCGAGGCCCTCGGCGAGGCCGCCGCACGACAAGCGCCTCGGCGTGCGCCACCCCTTGAAGCACCGCTGGTTTCGTGCTGGTGGGAAGATGATGATGGAGCCCGGAGGGGTGCTGCCTGCTCACGCGCATGAGGAGGAGGAGGAGGGAGCCAGCGAGGTGGAAGAGGAGGAGTTAGTGGAGGCGGAGGCCTCGTCCGCGGAGACGGTGACGTGGGGCGCTGAAGTGGAGGTGTCGTCCGCGCCGGCGGCAGGGGTGCAGGAGATGAACGCGGAGGTGGAGGGTGGCGAAATGGAGGTGTCGCCTGAGCCTGCGGTCGCTGTGGGGGGCACCGAGTTGGAGCCCCAGCAGGACGACGAGGACGAGGTCTCGTCCGTCGTGTTGGCGCGAGGGGAGAGGAAGCAGGAGGCGGCTCCTGCTTCTGCGGTGCTAGCTGTGGAGGCGCCCATGGAAATGGGTCAGGATGAGGAGAGGGCGGAGAAGGAGAAGAGGGGCAAGGAGAGGGAAAGGCAGAAGGAGCGGGAGAGGGTGGATGAGGTCGGCTACATGAGCGGAGGATGGAAGAGTGTTGATGGAACACTGAATTGTGGATATTCAAGTTTTAGAGGAAGAAGGGCAAGCATGGAAGATTTCTATGATATAAAAGCATCTAAAATTGATGATAAACAAATAAATCTCTTCGGAATTTTTGATGGTCATGGTGGTTCACGTGCTGCTGAGTATTTGAAGGAGCACTTGTTTGAGAACCTCATGAAACATCCGGAGTTCATGACAAATACAAAATTAGCATTAAGTGAAACATATAGAAAGACCGATTCAGAGTTTTTGGATGCTGAAAGGAATACTCATAGAGATGATGGGTCAACGGCATCGACAGCAGTGATGGTTGCTGATCATCTTTACGTGGCAAATGTTGGAGACTCGAGGGCTGTTATATCAAAGGCTGGCAAAGCTATTGCGCTCTCTGAAGATCACAAGCCAAACAGAAGTGATGAGAGGAATCGAATTGAGAGTGCTGGTGGGATAGTTATGTGGGCAGGAACTTGGAGGGTAGGTGGTGTACTTGCGATGTCTCGGGCATTTGGCAACCGTCTCTTAAAACAATTTGTTATTGCAGACCCTGAAATTCAGGAACAAGAAATAAATGAGGAGTTGGAGTTTCTAATTATAGCTAGTGATGGGCTGTGGGATGTGGTTTCGAATGAGGACGCTGTTACACTTGTGAAAATGGAGGAGGAACCAGAGGCTGCAGCTCGGAAGCTGACAGAGACCGCGTTCTCTCGCGGGAGCGGCGATAACATCACGTGCATCGTGGTGAAGTTCCAGCATGACAAGCCGCGCAGTGGCGGTGGCGATTCCCCTTCCTCGCCTCGTCTC
TFome clones do not contain stop codon at 3'end.
translation: MVYDGAVKDQDQETVAASTASAASVVAVSEASPAPVVVVVSARPSARPPHDKRLGVRHPLKHRWFRAGGKMMMEPGGVLPAHAHEEEEEGASEVEEEELVEAEASSAETVTWGAEVEVSSAPAAGVQEMNAEVEGGEMEVSPEPAVAVGGTELEPQQDDEDEVSSVVLARGERKQEAAPASAVLAVEAPMEMGQDEERAEKEKRGKERERQKERERVDEVGYMSGGWKSVDGTLNCGYSSFRGRRASMEDFYDIKASKIDDKQINLFGIFDGHGGSRAAEYLKEHLFENLMKHPEFMTNTKLALSETYRKTDSEFLDAERNTHRDDGSTASTAVMVADHLYVANVGDSRAVISKAGKAIALSEDHKPNRSDERNRIESAGGIVMWAGTWRVGGVLAMSRAFGNRLLKQFVIADPEIQEQEINEELEFLIIASDGLWDVVSNEDAVTLVKMEEEPEAAARKLTETAFSRGSGDNITCIVVKFQHDKPRSGGGDSPSSPRL