Tfome Clone Information

TFome Information for pUT6497

TFome Name pUT6497
Template BT062244
Genbank Insert ID KJ728220
Protein Name ZmOrphan148
Species Maize
TF Family Orphans
Gene ID GRMZM2G016749
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B935_F 3' Primer Name: B935_R
5' Primer Tm (º C): 66.2 3' Primer Tm (º C):
5' Primer Sequence: caccATGGTGGATGTGGAACTGTTTTATA 3' Primer Sequence: CAAGGAAGTTGATGCAGTCATCGT
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGGTGGATGTGGAACTGTTTTATAAGGACACTAGTGATCACAGCATTAGCTCTGAGGAAGAAGATATGCTTGTCAGGAGCTGTAGCAATCTCAATGTGAGCTTTGGATATCATTGTGATTCTTATCAGAGCTTTTCTCCTGAAAATGATCATGGAAATGACATTTCTCCTAAGAACATGTTTGGGACTAATACGATGATGGGGTCACGGAATGGCTCATTTACTTGTTTGTCCGGTGCTGCTATTAGTGCAAATTTTACATTGGCAAATACAAATATTTGCAATGGTCTTATTGGCGAAGAAATTTTACCAGAACTAGATTCTCCAAACTCCTTCAGAAAAATTATTTCATCTCCATCAATGTCAAGATTGGACTCGTTCTCTACCTCACAAGGCAGTCCTGTGTCAACTGAGAGCTCAATATTTGAGATCAGTAAAAATATTTGGAGGTCCAGTGCCCCAACAACTGTATCATCCAATTTTCTGACTAATACAGAGGTGAAAATGGCTGGCGGAGCTGCTGGAGAGGATAGAGTCCAAGCTGTGTGCTCAGAGAAAAATGGATGGCTGATTTGTGGGATATATGATGGGTTTAATGGGAGGGATGCAGCTGATTTTCTTGCGGTAACTCTATATGATAACATAGTATATTACTTATACCTGCTGGAGAATCGGATAAGGCAACAAAATGGTTTGTACAATTCATCAGAAAGCTCTCTTAATGGTCTCAAAAGTGAGTTAACACTAGCCATGAGAAATTCAGAAAATGAAGGCATAAAATTTTCTGAAACATTTCGATCTGGTGTACTGAATTGCCTTTCTACTGCTGTTGAGCAAGCTGAGAATGACTTTTTATGCATGGTTGAACAAGAGATGGATGATAGACCAGATTTAGTTTCGGTAGGGTCTTGTATCCTGGTTGTTCTTCTTCAAGGAACAGATCTGTGCATCTTAAATATGGGGGACAGTAGAGCTGTGCTTGCTTCCATGCCATATGTAGAAAATGGTGCTTTGAAGGCTACTCAACTGACAGAGACCCACTCGCTTGAAAATCCTTTGGAGTACCAAAAACTTTTAGCTGAACATCCCAATGATTCTTCAGTTGTCAGGGGTAACAAAATAAAAGGAAAGCTGAAGGTTACTCGTGCTTTTGGAGTTGGCTATCTAAAGCAGAGGAAGTTCAACGACGCACTCATGGGCATTCTGCGAGTCCGCGATTTGAGCAGCCCTCCATATGTTTACACAAATCCACACACATTGAGTCACAAAGTTACAGATGATGATTTGTTTGTTGTGCTTGGTAGTGATGGCTTATTTGATTTCTTCAGCAATGATGAAGTTGTTCGGTTGGTTTATCAATTTATGCATGATAATCCAATGGGGGATCCTGCAAAATATCTTATTGAGCAACTTATACTCAAAGCAGCCAAGGAAGCAGCTCTAACAGCCGAAGAATTGATGAGGATACCTGTTGGGAGTAGGAGAAAGTACCACGATGATGTGACTGTCATTGTTATCATCCTTGGAAATGCACAGAGGACGATGACTGCATCAACTTCCTTG
TFome clones do not contain stop codon at 3'end.
translation: MVDVELFYKDTSDHSISSEEEDMLVRSCSNLNVSFGYHCDSYQSFSPENDHGNDISPKNMFGTNTMMGSRNGSFTCLSGAAISANFTLANTNICNGLIGEEILPELDSPNSFRKIISSPSMSRLDSFSTSQGSPVSTESSIFEISKNIWRSSAPTTVSSNFLTNTEVKMAGGAAGEDRVQAVCSEKNGWLICGIYDGFNGRDAADFLAVTLYDNIVYYLYLLENRIRQQNGLYNSSESSLNGLKSELTLAMRNSENEGIKFSETFRSGVLNCLSTAVEQAENDFLCMVEQEMDDRPDLVSVGSCILVVLLQGTDLCILNMGDSRAVLASMPYVENGALKATQLTETHSLENPLEYQKLLAEHPNDSSVVRGNKIKGKLKVTRAFGVGYLKQRKFNDALMGILRVRDLSSPPYVYTNPHTLSHKVTDDDLFVVLGSDGLFDFFSNDEVVRLVYQFMHDNPMGDPAKYLIEQLILKAAKEAALTAEELMRIPVGSRRKYHDDVTVIVIILGNAQRTMTASTSL