Tfome Clone Information

TFome Information for pUT6502

TFome Name pUT6502
Template BT033574
Genbank Insert ID KJ728225
Protein Name ZmOrphan224
Species Maize
TF Family Orphans
Gene ID GRMZM2G113016
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: B942_F 3' Primer Name: B942_R
5' Primer Tm (º C): 74.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGACGACCGCCGCGAGGGAG 3' Primer Sequence: CCTGCATGCTGTGGAGCAGCTA
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGACGACCGCCGCGAGGGAGAGGCGCCTGCCGCCGACGCTGCCCCTGGCCACGCTTATCGGTCGCGAGCTCCGTGCGGGGGGCTCCGAGCGCCCGGCCCTGCGCTACGGCCACGCCGGCTTCGCCAAGCGCGGCGAGGACTACTTCCTCGTCAAGCCCGACTGCGTCCGCGTCCCCGGGGACCCCGCATCGGCGTTCTCAGTTTTCGCCGTGTTCGACGGCCACAACGGCGTGTCGGCGGCGGTCTATAGCAAAGAGCATCTGCTCGAGCACGTCATGAGCGCGCTGCCGCCGGACATCGGGCGCGACGACTGGCTGCAGGCGCTGCCGCGCGCTCTCGTCGCCGGCTTTGTCAAGGCCGACATTGATTTCCAGCGCAAGGGGGAGGTGTCAGGAACCACGGCGACACTGGTGGTCATCGATGGGTTCACGGTCACAGTGGCGTCGGTGGGAGACTCGCGCTGCATCCTGGACACGCAGGGCGGCGAGTTGCAGCTGCTAACCGTGGACCACCGCCTGGAGGAGAATGCAGAGGAGCGGGAGCGCGTCACGGCCAGCGGTGGGGAAGTAGGCCGGCTCAATCTCTTCGGTGGTCAGGAGGTTGGTCCTCTCCGGTGCTGGCCTGGTGGCTTGTGCCTTTCAAGATCCATTGGGGACATGGATGTTGGGGAGTACATTGTGCCCATTCCACATGTCAAGCAAGTCAAGCTATCAAACGCTGGAGGAAGGCTGATAATAGCATCCGATGGCATATGGGATGCATTATCCAATGAAGCAGCTGCAAAAGCATGCAGAGGATTGCCTGCAGAACTGGCAGCGAAGCTTGTCGTTAAGCAAGCTCTGAAAACAAGCGGGCTAAAGGATGACACCACCTGTGTTGTAGTTGACATTATCCCATCCGATCATTTGACATCACCACAATTGTCTCCAAAGAAAAATCATAACAAGTTGAAGTCACTTTTTCGTAGAAGGTCGCATAGTTCTGTTGGAAAGCTCGGGGGCAAGTCTGCCTCCATTGGTTCTGTGGAGGAGTTATTTGAAGAAGGCTCTGCAATGTTAGAAGAAAGGTTGGGCAGGAATTTGTCTTTGAAAGCAGTTTCAGCACCTTTTCGCTGTGCAATCTGCCAAGTGGACCAAGAGCCCTTCGAAGATTTGATGAGAGATAATGGAGGTGGTTACTGCTCTTCCCCATGCGCTCCATGGGGTGGTCCATATCTCTGTTTGGACTGTCGGAAAAAGAAAGATGCAATGGAAGGTAAAAGATCTAGCTGCTCCACAGCATGCAGG
TFome clones do not contain stop codon at 3'end.
translation: MTTAARERRLPPTLPLATLIGRELRAGGSERPALRYGHAGFAKRGEDYFLVKPDCVRVPGDPASAFSVFAVFDGHNGVSAAVYSKEHLLEHVMSALPPDIGRDDWLQALPRALVAGFVKADIDFQRKGEVSGTTATLVVIDGFTVTVASVGDSRCILDTQGGELQLLTVDHRLEENAEERERVTASGGEVGRLNLFGGQEVGPLRCWPGGLCLSRSIGDMDVGEYIVPIPHVKQVKLSNAGGRLIIASDGIWDALSNEAAAKACRGLPAELAAKLVVKQALKTSGLKDDTTCVVVDIIPSDHLTSPQLSPKKNHNKLKSLFRRRSHSSVGKLGGKSASIGSVEELFEEGSAMLEERLGRNLSLKAVSAPFRCAICQVDQEPFEDLMRDNGGGYCSSPCAPWGGPYLCLDCRKKKDAMEGKRSSCSTACR