Tfome Clone Information

TFome Information for pUT6503

TFome Name pUT6503
Template BT065915
Genbank Insert ID KJ728226
Protein Name ZmOrphan226
Species Maize
TF Family Orphans
Gene ID GRMZM5G836628
transcript T02
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: C500_F 3' Primer Name: C500_R
5' Primer Tm (º C): 74.1 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCGACCGCCGCGAGG 3' Primer Sequence: CCTGCATGCTGTAGAGCGGCTA
PCR Condition: PCR Conditions: Volumes per reaction (25l): 5 l GC
Nucleotide Sequence: ATGGCGACCGCCGCGAGGGAGAGGCGCCTGCCGCCGGCGCTGCCCCTGGCGACTCTCATCGGCCGGGAGCTCCGCGCGGGGGGCTCCGAGCGCCCGGCCCTGCGCTACGGCCACGCCGGCTTTGCCAAGCGTGGCGAGGACTACTTCCTCGTCAAGCCCGACTGCCTCCGCGTCCCCGGGGACCCCGCATCCGCGTTCTCCGTCTTTGCCGTGTTCGACGGCCACAACGGCGTGTCGGCGGCGGTCTACAGCAAGGAGCATCTGCTCGAGCACGTCATGAGCGCGCTGTCGCCGGACATCGGCCGCGAAGACTGGCTGCAGGCGCTGCCGCGCGCGCTCGTCGCCGGCTTCGTCAAGGCCGACATCGATTTCCAGCGCAAGGGGGAGGTGTCCGGAACCACGGCGACACTGGTGGTCATCGATGGGTTCACGGTCACGGTGGCGTCGGTGGGTGACTCGCGCTGCATCCTGGACACGCAGGGCGGCGAGTTGCAGCTGCTAACCGTGGACCACCGCCTGGAGGAGAATGCAGAGGAGCGGGAGCGCGTCACGGCCAGCGGTGGGGAAGTAGGCCGGCTCAATCTCTTTGGCGGCCAGGAGGTCGGCCCTCTCCGGTGCTGGCCTGGTGGCTTGTGCCTCTCAAGATCCATCGGGGACATGGATGTTGGAGAGTTCATTGTGCCCATTCCACATGTCAAGCAAGTCAAGCTATCAAACACCGGAGGAAGACTGATAATAGCATCTGATGGCATATGGGACGCGTTGTCCAATGAAGCAGCTGCAAAAGCATGCAGAGGATTGCCTGCAGAACTGGCAGCGAAGCTTGTCGTTAAGCAAGCTCTGAAAACAAGCGGGCTAAAGGATGACACCACCTGTGTCGTAGTTGACATTATCCCGTCCGATCATCTGACATCGCCACAATTGTCTCCAAAGAAAAATCAGAACAAGTTGAAGTCACTTTTTCGTAGAAGGTCGCATAGTTCAGTTAGAAAGCTTGGAGGCAAGTCTGCCTCCATTGGTTCCGTGGAGGAGTTATTTGAAGAAGGGTCTGCAATGCTAGAAGAAAGGTTGGGTAGGAATCTGTCCTTGAAAGCAGCTTCACCACCTTTCCGCTGTGCAATCTGCCAAGTGGACCAAGAGCCCTTCCAAGATTTGATGGCAGATAATGGAGGTGGTTACTGCTCTTCCCAGTACGCTCCATGGGGTGGCCCATGTCTCTGTTTGGACTGTCGGAAAAAGAAAGATGCAATGGAAGGAAAAAGATGTAGCCGCTCTACAGCATGCAGG
TFome clones do not contain stop codon at 3'end.
translation: MATAARERRLPPALPLATLIGRELRAGGSERPALRYGHAGFAKRGEDYFLVKPDCLRVPGDPASAFSVFAVFDGHNGVSAAVYSKEHLLEHVMSALSPDIGREDWLQALPRALVAGFVKADIDFQRKGEVSGTTATLVVIDGFTVTVASVGDSRCILDTQGGELQLLTVDHRLEENAEERERVTASGGEVGRLNLFGGQEVGPLRCWPGGLCLSRSIGDMDVGEFIVPIPHVKQVKLSNTGGRLIIASDGIWDALSNEAAAKACRGLPAELAAKLVVKQALKTSGLKDDTTCVVVDIIPSDHLTSPQLSPKKNQNKLKSLFRRRSHSSVRKLGGKSASIGSVEELFEEGSAMLEERLGRNLSLKAASPPFRCAICQVDQEPFQDLMADNGGGYCSSQYAPWGGPCLCLDCRKKKDAMEGKRCSRSTACR