TFome pUT6548
Template Genomic DNA
Genbank Insert ID KJ728271
Protein Name ZmGATA30
Species Zea mays
TF Family C2C2-GATA
Gene id GRMZM2G464037
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information Deposited to ABRC

TFome pUT6548

Placeholder text:
"TFome" is used as a synonym for "clone".
"TFome" is short for "transcription factor open reading frame".

5' Primer

Name P10up
Temperature (ºC) 63.6
Sequence
Copy to clipboard
caccATGAGCAATCAACCACCTCACGC

3' Primer

Name P10dn
Temperature (ºC)
Sequence
Copy to clipboard
TGACCCAGCTGTTCCGTTCTGC

PCR Condition

mix per 25l reaction: 5 l GC buffer 5 l 5x CES 1.5

Amino Acid Sequence
Copy to clipboard

MSNQPPHASLQDDLPDCDGDDPLALAIRLFPAHTTGAGLSPAALGIGRVAEPPRREQEPLANSTYGVRGAGPDPWGLRLSRSVLGGLDGFDVDTFFADDALDGGGEATEGDSPPAHVTAAARGSLANDDASPLPAAMPAVALEAYDACSAPVPAACGGAPPVLVANNSMPPASCLGARGALYIVSKRTRTHAPPPLAAESMTPAVAPPPAMPDGGNGGNNRSAALPVALAPPSGSTGGAVRRRRPVPRPRNREVQRTCSHCQSSKTPQWREGPDGRRTLCNACGLRYKSHRLVPEYRAAESMTPRDLHPNAGLVGASSGPSSRPSSSSTTTPSQSQIDFPSHALPAVAPPPAMPDPDGGNGGNNRSAALPVALAPPSGSTGGAVRRRRPVPCPRNRQVQRTCSHCQSSETPQWREGPDGRRTLCNACGLRYRSHRLLPEYRPTTSPSFQIGQHSNRHRRIMQIREQNGTAGS

TFome clones do not contain stop codon at 3'end.

CDS
Copy to clipboard

ATGAGCAATCAACCACCTCACGCCTCGCTGCAGGATGACCTCCCGGACTGCGACGGCGACGACCCGCTCGCCCTTGCCATCCGGCTCTTCCCCGCCCACACCACCGGCGCGGGTCTATCGCCGGCGGCGCTCGGCATAGGCCGCGTCGCCGAGCCGCCCCGTCGGGAGCAGGAGCCACTGGCTAATAGCACGTATGGCGTACGCGGAGCCGGGCCGGATCCTTGGGGCCTGCGCCTGTCCAGGTCCGTTCTTGGGGGCCTCGACGGATTTGACGTGGACACATTCTTTGCTGACGACGCGCTGGACGGCGGCGGCGAGGCGACCGAAGGCGACTCGCCGCCGGCGCACGTGACAGCCGCCGCGCGCGGCTCGTTGGCCAACGACGACGCGTCGCCGTTGCCCGCGGCCATGCCAGCCGTCGCCCTTGAAGCGTACGACGCGTGCAGTGCACCTGTGCCAGCAGCATGCGGTGGCGCGCCGCCCGTCCTTGTCGCCAACAACAGCATGCCGCCAGCTAGCTGTCTCGGCGCGCGCGGTGCACTTTACATTGTCTCCAAACGCACACGCACGCATGCGCCGCCGCCACTAGCGGCGGAATCCATGACACCGGCAGTCGCTCCTCCTCCAGCCATGCCCGACGGTGGGAACGGTGGCAATAACCGGAGCGCCGCCTTACCTGTCGCTCTCGCTCCTCCGTCCGGGAGTACCGGTGGCGCCGTCCGCCGGCGCCGTCCCGTGCCACGCCCGCGGAACAGGGAAGTCCAGAGGACGTGCAGCCACTGCCAGTCGTCAAAGACGCCGCAGTGGCGCGAGGGCCCGGACGGGCGAAGAACCCTGTGCAACGCGTGCGGGCTACGCTACAAGTCGCATAGGCTGGTGCCTGAGTACCGGGCCGCAGAATCCATGACACCACGCGATCTCCACCCAAACGCTGGGCTGGTCGGCGCGTCTTCAGGTCCGAGCAGCCGCCCGTCGTCGTCATCTACAACGACGCCATCGCAGTCGCAGATCGACTTCCCATCCCACGCCTTGCCGGCAGTCGCTCCTCCTCCAGCCATGCCCGATCCCGACGGTGGGAACGGTGGCAATAACCGGAGCGCCGCCTTGCCTGTCGCTCTCGCTCCTCCGTCGGGGAGTACCGGTGGCGCCGTCCGCCGGCGCCGTCCCGTGCCATGCCCGCGGAACAGGCAAGTTCAGAGGACGTGCAGCCACTGCCAGTCGTCGGAAACGCCGCAGTGGCGCGAGGGCCCGGACGGGCGAAGAACCCTGTGCAACGCGTGCGGGCTACGCTACAGGTCGCATAGGCTGCTGCCTGAGTACCGGCCGACGACGTCTCCTAGCTTCCAGATCGGGCAGCACTCTAATCGCCATCGGAGGATTATGCAGATCAGGGAGCAGAACGGAACAGCTGGGTCA


Copyright © 2023 Grassius.org | Last updated: 2023-06-26