Tfome Clone Information

TFome Information for pUT6564

TFome Name pUT6564
Template BT042239.1
Genbank Insert ID KJ728285
Protein Name ZmMYB75
Species Maize
TF Family MYB
Gene ID GRMZM2G070849
transcript T01
Vector pENTR/SD/D-TOPO
Note c.G213T;G694A;G966T; p.V232I;W322C; Not present in template FlcDNA sequence. Not present in functional domains.
Request Information: Deposited to ABRC
5' Primer Name: B299_F 3' Primer Name: B299_R
5' Primer Tm (º C): 70.7 3' Primer Tm (º C):
5' Primer Sequence: caccATGGACATGGCGCACGA 3' Primer Sequence: CACGCCCTGCGCCTGCGTGAACC
PCR Condition: Volumes per reaction (25l): 5 l GC buffer (Thermo
Nucleotide Sequence: ATGGACATGGCGCACGAGAGATCAGACGCCAGCAGCGAGGAGGAGGTGATGGCCGGCGAGCTGCGGCGCGGGCCTTGGACGGTGGAGGAGGACCTCCAGCTGGTCAACTACGTCGACGCGCACGGCGAGGGCCGCTGGAACTCGCTCGCCCGATCAGCAGGTCTGAAGCGCACTGGCAAGAGCTGCCGCCTCCGGTGGCTGAACTACCTCCGTCCCGACCTCCGGCGCGGCAACATCACGCCGCAGGAGCAGCTGATGATCCTGGAGCTGCACTCGCGCTGGGGCAACCGCTGGTCCAAGATCGCGCAGCACCTCCCCGGGCGCACCGACAACGAGATCAAGAACTACTGGCGCACGCGCGTGCAGAAGCACGCCAAGCAGCTCAAATGCGACGTCAACAGCCAGCAGTTCAAGGACGTGATGCGCTACCTCTGGATGCCCCGCCTCGTCGAGCGCATCCAGGCCGCCGCAGCCAACAATAACGCCAGCGGCGCCGGGGTTCCGCCAGCTGGCGCCGCCGCGGACGACACGCCGCTCTCGTCGTCGTGGCAGCACGGCGGCGGCGCCGACGACGACGGCGGCCTCTACGCGTCGCCGGAGCTGCCCACGGACGCCTGCTGGCCTCCCGCAGACTGCTACTACTACCCAGCCGCCGCTGACCACCAGCTACTGAACAACCCCGCCGCCGCCGCCATCTTCCCGGACCTGTCAAGCACCACGGCCGGGTCGTCCTCTCCGTCCTCGGATTCCGGCGCGGGGACAGCACAACCCTGGCCCGCGCCGCTGGGTGGCGCAGAGTGGTTGACCACCGGCGCCTGCTGCGACGCCTCCAGCGCCGCCGCCGCCCTGGGCGGGCAGCAGCAACAATCGTGCCTGGTCGGGGAGACGTCGTGGGCGTCATCCGAGCTCCCCGAGCTGGGCGTCGCGGACTTCGAGATCGGCAGCTTCGACGTGGAGAGCATCTGTAGCATGGACGACAGCCTGTGGTTCACGCAGGCGCAGGGCGTG
TFome clones do not contain stop codon at 3'end.
translation: MDMAHERSDASSEEEVMAGELRRGPWTVEEDLQLVNYVDAHGEGRWNSLARSAGLKRTGKSCRLRWLNYLRPDLRRGNITPQEQLMILELHSRWGNRWSKIAQHLPGRTDNEIKNYWRTRVQKHAKQLKCDVNSQQFKDVMRYLWMPRLVERIQAAAANNNASGAGVPPAGAAADDTPLSSSWQHGGGADDDGGLYASPELPTDACWPPADCYYYPAAADHQLLNNPAAAAIFPDLSSTTAGSSSPSSDSGAGTAQPWPAPLGGAEWLTTGACCDASSAAAALGGQQQQSCLVGETSWASSELPELGVADFEIGSFDVESICSMDDSLWFTQAQGV