Tfome Clone Information

TFome Information for pUT6565

TFome Name pUT6565
Template BT039909.1
Genbank Insert ID KJ728286
Protein Name ZmHB38
Species Maize
TF Family Homeobox
Gene ID GRMZM2G013617
transcript T01
Vector pENTR/SD/D-TOPO
Note c.G479T p.G160V Not present in template FlcDNA, not located in functional domain.
Request Information: Deposited to ABRC
5' Primer Name: C253_F 3' Primer Name: C253_R
5' Primer Tm (º C): 63.3 3' Primer Tm (º C):
5' Primer Sequence: caccATGGCCATCCACCACCC 3' Primer Sequence: CCCAGCGAAATGATGCAGCAA
PCR Condition: 5 l GC buffer (NEB) 1 l primer forward 20mM 1 l pr
Nucleotide Sequence: ATGGCCATCCACCACCCGCACCTCCTCGACTTCTCGCCGCCTCCGAACACGGTGGCCATGGAGGAGGCGCCGCCCCCACCCCACTTCGACCACGGCCTCCTCGGGCTCCATGTCGATGGCATGCCTCATCGCGTCCTCGCCGACGACGCGCCGGTGGCGGCATGGGCGCCGCAGGCCGTGGTCTCCCACTCCCTGTACGGATACGATAACACAGCAGCGGGGGCGTCGTCGCTGTTTGGCCACCATGAGGCATCAGAGGCCCAGTTCTCCGTGCTTCCGCCGGCAGCGTCGTCGTTTGCACTACTACCTAACCACCACCACCAGCAGCAGCTGCCGACGACGACGGCGGCGTCGAGCATGCAGCAGCCGTTCCAGCTGAGGAGCTCCAAGTACCTGGGTCCTGCGCAGGAGCTGCTCGCCGAGTTCTGCAGCCTGGAAGGGGACCTGCTGCACGCCACGAACAAGCAGGGAGCTTCCGTAGCAGCAGCAGGTAACAGCAGGTGGGACGACGTGGAGACGTCGTCGTCTTCTTCTGCTGGCCTCTGGGGGCACCTGTCCCTGAGCTCCATGGATCTCCTGGAGCTCGAGAGGAGGAAGGCCAGGCTCTTGTCCATGGTTGAAGAGGTGGACCGGCGGTACCGGCGATACCGCGAGCAGATGAGGTCAGTGGAGGTGTCGTTCGAGGCGGTGGCCGGAGCCGGCGCGTCGCAGGTGTACACGCGGCTGGCGCTGCGGGCCATGTCGCGGCACTTCCGGTGCCTGCGGGATGCGCTGGTGGCGCAGGTGCGCGCTCTGCGGAAGGCCATGGGGGAGAGGGACGGCGGCCCAGCTGGTGCGGCGGCGGGCGCCACCAAGGGCGACACGCCCAGGCTCAAGGTGTTGGACCAGTGCCTGCGGCAGCAGCGGGCGTTCCAGCACCCGGGCACCATCGACAACTACCCGTGGCGGCCCCAGCGCGGCCTGCCGGAGCGCGCCGTCGCCGTCCTCCGAGCCTGGCTCTTCGAACACTTCCTCCACCCGTATCCGAACGATGTGGACAAGCACATTCTAGCGCGCCAGACAGGACTGTCAAGAAGCCAGGTTTCCAATTGGTTCATCAACGCCAGGGTGAGGCTGTGGAAGCCGATGATAGAGGAGATGTACACGGAAGAAGTGAACCCGAAACCGGCCGACGACACAAGCCAAAACCCTAGCGCCGGTGGCGGCGTCGGCGTCGGCGTCGCCATCAAACCTGAGCAGCAGGTGAGCACAGCTGCGGCGGGAGCCACCATCGGAGGCGGCGGCGGCGACCATCTGTTCGGTCCTAGTTATCCCAGCATGTACGGGAGCCACGGCGGCGCCGTGTCGCTTACCCTAGGGCTCCAGCAGCAGCCGTTTGCGTCGACGATGATGCACCAGCGACGACCACTGATGACGTTTCAAGGTGACGAGCAAGAGCCGGCGCTGCCGTACAGAGACCTTATGGGCTCTCAGTTGCTGCATCATTTCGCTGGG
TFome clones do not contain stop codon at 3'end.
translation: MAIHHPHLLDFSPPPNTVAMEEAPPPPHFDHGLLGLHVDGMPHRVLADDAPVAAWAPQAVVSHSLYGYDNTAAGASSLFGHHEASEAQFSVLPPAASSFALLPNHHHQQQLPTTTAASSMQQPFQLRSSKYLGPAQELLAEFCSLEGDLLHATNKQGASVAAAGNSRWDDVETSSSSSAGLWGHLSLSSMDLLELERRKARLLSMVEEVDRRYRRYREQMRSVEVSFEAVAGAGASQVYTRLALRAMSRHFRCLRDALVAQVRALRKAMGERDGGPAGAAAGATKGDTPRLKVLDQCLRQQRAFQHPGTIDNYPWRPQRGLPERAVAVLRAWLFEHFLHPYPNDVDKHILARQTGLSRSQVSNWFINARVRLWKPMIEEMYTEEVNPKPADDTSQNPSAGGGVGVGVAIKPEQQVSTAAAGATIGGGGGDHLFGPSYPSMYGSHGGAVSLTLGLQQQPFASTMMHQRRPLMTFQGDEQEPALPYRDLMGSQLLHHFAG