Tfome Clone Information

TFome Information for pUT6596

TFome Name pUT6596
Template RT-PCR
Genbank Insert ID KJ728315
Protein Name ZmMYB25
Species Maize
TF Family MYB
Gene ID GRMZM2G431156
transcript T01
Vector pENTR/SD/D-TOPO
Note c.60del180. c.A522G p.(=) Not supported in RNA-seq.
Request Information: Deposited to ABRC
5' Primer Name: CD0146_F 3' Primer Name: CD0146_R
5' Primer Tm (º C): 77.0 3' Primer Tm (º C):
5' Primer Sequence: caccATGGGGAGGTCGCCGTGCTGCGAGA 3' Primer Sequence: GCCTGCCTGGCAGCCGCACGCTTCC
PCR Condition: PCR Conditions: Volumes per reaction (30l): 6 l GC
Nucleotide Sequence: ATGGGGAGGTCGCCGTGCTGCGAGAAGGGGCACACCAACAAGGGCGCGTGGACCAAAGAGCTGCACGCCCTCCTCGGCAACAAGTGGTCTCTGATCGCCGGGCAGCTGCCGGGCCGGACGGACAACGAGATCAAGAACTACTGGAACACGCACATCAAACGCAAGCTCCTGGCCCGCGGCATCGACCCGCACGCGCACCACCGCCCGCAGGCGCTGCACCACGTGGCAGCAGCAGCCCTCGTCCCGGCCCCCGCCGCGAAGCCGAAGCCGAAGCCGGCGGAGTCGTCCGACGACGGCGGGCGCAGCAGCTGCAGCTGCAGCGGCAGCGGCAGCAGCGCGGGAGAGCCGCGGTGCCCCGACCTCAACCTCGACCTGTCCGTTGGTCCGCCGGACGCGCCCACCTCGCCGCCGCCGCCGTGCCTGTGCCACCGCGCCTGGGAAGCGTGCGGCTGCCAGGCAGGC
TFome clones do not contain stop codon at 3'end.
translation: MGRSPCCEKGHTNKGAWTKELHALLGNKWSLIAGQLPGRTDNEIKNYWNTHIKRKLLARGIDPHAHHRPQALHHVAAAALVPAPAAKPKPKPAESSDDGGRSSCSCSGSGSSAGEPRCPDLNLDLSVGPPDAPTSPPPPCLCHRAWEACGCQAG