Tfome Clone Information

TFome Information for pUT6794

TFome Name pUT6794
Template Synthesized template
Genbank Insert ID KJ728489
Protein Name ZmMYB85
Species Maize
TF Family MYB
Gene ID GRMZM2G077789
transcript T01
Vector pENTR/SD/D-TOPO
Note
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 3' Primer Tm (º C):
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGGGGAGGTCGCCGTGCTGCGAGAAGGCGCACACCAACAAGGGCGCGTGGACCAAGGAGGAGGACGAGCGGCTGGTGGCGTACGTCCGGGCGCACGGGGAGGGGTGCTGGCGCTCGCTGCCCAAGGCGGCGGGGCTGCTGCGCTGCGGCAAGAGCTGCAGGCTGCGCTGGATGAACTACCTCCGCCCGGACCTCAAGCGCGGCAACTTCACCGACGACGAGGACGAGCTCATCATCCGCCTGCACAGCCTCCTGGGCAACAAGTGGTCCCTCATCGCCGGGCAGCTGCCTGGCCGGACGGACAACGAGATCAAGAACTACTGGAACACGCACATCAAGCGCAAGCTCCTCGCCCGCGGCATCGACCCGAAGACGCACCGCCCGCTCGGCGCCGGCGCCGACGCCGCCGCGCCACCCGGCGTGGTCGCGCACCGGGCGCTGCTGCACCGCGCAGGCGCAGCCCCCGTCGAGCTCGCCGTGAAGCCGGCGCCGGCGGAGTCATCCGACGACGGCGGCCGGAGCAGCGCCAGCGCCAGCAGCGGCGGCGGCGCCAGCGTGGAGGAGCCGCGGTGCCCCGACCTCAACCTCGACCTGTCCGTGGGCCCGCCAGCGGCCGCCGACACGCCCACCTCGCAGTCGCAGCTGGCGGTGTGCCTGTGCTACCGCCTGGGCCTCCGCGCCGGGGAGGCGTGCAGCTGCCAGGCTCAGGCTGACAACGCGGGCCAGCAGCGGTTCAGATTTTCAGATTTCAGAACCGAGAGGAGAGTCGTTAAG
TFome clones do not contain stop codon at 3'end.
translation: MGRSPCCEKAHTNKGAWTKEEDERLVAYVRAHGEGCWRSLPKAAGLLRCGKSCRLRWMNYLRPDLKRGNFTDDEDELIIRLHSLLGNKWSLIAGQLPGRTDNEIKNYWNTHIKRKLLARGIDPKTHRPLGAGADAAAPPGVVAHRALLHRAGAAPVELAVKPAPAESSDDGGRSSASASSGGGASVEEPRCPDLNLDLSVGPPAAADTPTSQSQLAVCLCYRLGLRAGEACSCQAQADNAGQQRFRFSDFRTERRVVK