Tfome Clone Information

TFome Information for pUT6817

TFome Name pUT6817
Template Synthesized template
Genbank Insert ID KJ728512
Protein Name ZmMYB45
Species Maize
TF Family MYB
Gene ID GRMZM2G051793
transcript T01
Vector pENTR/SD/D-TOPO
Note This construct was synthesized with codon optimization for yeast.
Request Information: Deposited to ABRC
5' Primer Name: 3' Primer Name:
5' Primer Tm (º C): 3' Primer Tm (º C):
5' Primer Sequence: 3' Primer Sequence:
PCR Condition:
Nucleotide Sequence: ATGGATTGGTATTCTGATGATTCTGATCCAGACATCGACGAAGATTTGAGAGAAGATTTGGATGCCTTGAGAAGATCCTGTATTTTGTCTGGTGCTGATCCAGATGCTGCTGTTGCTCAAGTTTCTTCTGGTTTGGCTGGTCCATCTACTCCAGCTTTGGCTGCTGCTCCAGGTGCTGCAGCTGATCATCATCATCATGCTTCATCTTCAGATGATGAAGAAGATGAAGATTTGGCCTTGGTCAGATCTATTAGAGCTAACTTGCATCACTTGCATAACTCTAAGGCTTCTACTGTTTTGCCAGATGCTGCACCAGCTCCAAGAGATGATGATGACCCATCTTCTAGACCAATATGTACTTGGCCACCATCTGATACAGACGAAGAAGAAGATGATTTGGAAACCTTGAGAGCCATCCAAAGAAGATTCTCTCATTACCAATCTTCTACCTCTACTGCTTCTCCAAAAACTATGAAGCCTGAAGCTTCTCAAGGTGTTCATTCTGATTTGTTCGCTGATAGATCTGGTGATGATTTCGCTGTTCAAAAGCAAAATGCTATCGTTCCACATGGTGATGGTTTTCCAAAAGCTGCTTTGTTGTTGGTTGATGCTTTGAAGAAGAACAGAGCCTACCAAAAGTTCATTAGAAGAAAGATGGTTAACATCGAAGCCAAGATCGAAGAAAACAAGGATTTGAGAGATAGAGTCAAGTGCTTGTTGGGTTACCAATTGTCTTGTAGAAAGTCCGTCAGTAGATCCTTGGGTCAAAAAGAAGATCCAAGAGTCAGATTGATCTCCCCATTGAAATCTACTCAACCATGTACCAAGAACAAGTACAGAAAGATTCCAGCTTTGTTTTTGGGTCCAGCTGAAAATCCACATGTCTCTAAATACGAAATGGCCTTGAAGCAATTCCCAATGTCCTTTAAAAAGCAACCATGGTCTGATGCCGAAAAGGATAAGTTGGCTAGAGGTATTAAGCAACAATACCAAGAAACCTTGATCTTGGACTCTTTGAACAATGGTTCTGCTGATGGTGATTTCTCTGCTTTGGATATGGCTTACGCTTTGACTAATGGTGCTGGTAATTTTGAAGTTACCCCAGAAAACTTGAGATCCGTTTTGCCATTGATTAACTGGGATAAGATTTCCGCTATGTACTTGCCAGGTAGATCTGGTGCTGAATGTGAATCTAGATGGTTGAATTGTGATGACCCATTGATCAATCATGAAGCTTGGACTGCTGATGAAGAAACCAGATTGTTGTTGATCATCCAAGAAAAGGGTATGTGCAACTGGATTGATATTGCTGTTACTTTGGGTACTTACAGAACCCCATTTCAATGCTTGGTTAGATACCAAAGATCCTTGAACCCACACATTTTGAACAAAGCTTGGACCAAAGAAGAAGATTTGCAATTACAAGCTGCCGTTGAAACTTTTGGTCAAAAGTGGCAATTGGTTTCCGCTTCTTTAGATGGTAGAACTGGTACTCAATGTTCCAACAGATGGAGAAAAACATTGCATCCAGAAAAGACCTCTGTTGGTAGATGGTTGTTGGATGAAGATAAGAGATTGATGGTTACCGTCAAGTTGATTGGTCCAGGTAGATGGTCTTTGATTGCTCCTTTTATTCCAGGTAGAACCCAAACCCAAATTTTCGAAAGATGGTGCAACATTTTGGACCCAGACTTGTATTTGGATGATTGGAGGCCAGATGAAGATTCTACTTTGTTGGCTGCTGTTTCTGAATTTGGTCCATGTTGGTCTAAGATCTCCAAGACTATTATCCCAGGTAGAAACGATTCTATGTGCTATAGAAGATGGAGAAAGTTGTGCAAGCACGAAGTTCAAAAAGCTAGAGAAGCTAGACAATTGAAGAAGGCCATTTTCCAAAACAACTTCGTCGATAGAGAAAAAGAAAGACCAGCTATTTGCCCAAGAGACTTGATTTCTTTGTTGCCATCTAAAGGTGATGGTTGTGATGTTGCTATCGTTAGATACTGCAAGTTCTTGTGTTCCTCCTGCATTTTGATTTCATTGGGTGGTTCTGAAAAGCAAGGTGAAGAAAATCATTTGGCCTTGTCCAATATCGTCAACATCTCTTCTGGTTTAGATTGCGTTGCTGCTAACTCTGTTTTGAACGCTTCTTCAAGAAGGCCAAGAAGAGTTTCTTCAGGTAGAAGATCTAAGAAGCACACTGAAGGTAACAATATTGCTGCTCCAGATGATTTGAATGCTTCTTCTTCTGCTCCATCCTCATCCATTAAGAGAAAATCTACTACCGGTAACAATGTTGCCGCTAAGAAAAGATCCAGAGTTTCCATTTCTGTTAACGCCGATAACGAAGTCGAAAAGAACAGAATTACTGATTCCGTTGCCGTTTCTGAAGAAGGTTTGGTTAAGAAAAGAACGAGAAGGCCAAAACCAGTTGGTAATGAAGGTGCTGTTAGAAAAAGAGGTGGTTCCAACAACGAAGTTGGTACAAACATTATCACCGAATCTGTTGCTGTTGGTGAAGAAGGTGTTGTCAAAAAGAGAACCAGAAGATCTAAACCAGTCGGAAACGAAGGTGCAGATAATGAAGTTGGTACTTATAGAATCACCGGTTCCGTTGTTGTCGGAGAAGAAGGCGTTGTAAAGAAAAGGACTAGAAGATCCTCTAAGCCAGTTGATAACGAAGAGGTTGTTAGAAAGATGAGAGGTTCCATCAACAATTATGATGAAGCCGGTACTAATACCATGATGAATTCTGCATTCGGTGAAGAAGAAGTCGTCAAGAAAAAAACCAGACATTCAAAGCCAGTAGGTACAGAAGGTGCCGCTTCTATTGGTGGTGATGGTATGGTTAACAAAAGAAGAACTGGTTCCGTTTCCACTGAAAACTTGGGTGCAGTTAGAAAGAGAAAGATCGTCAGTTCTAGAAGAAAGTTGGCCGAAGTTAATTTGCCAACCGAAGAAGGTGTCCCAAACGCTGTTCCAGATTTGGATTTTCCATGTGCTATCTCTGAAGAAAGAGCTGTTGACGTTGGTAATATGGATAAGGGTAGAAGAAAGTCTACTCCAAGACCAAAGCAAATCAACATGCCTGAAGAAGATGCTGATAAGAACTCTACTTTCACCAGATTGGTTAACTGCTTGTCTTTCGCTAGAATGAAGGGTATCGATAGAAACAAGAGGTAA
TFome clones do not contain stop codon at 3'end.
translation: MDWYSDDSDPDIDEDLREDLDALRRSCILSGADPDAAVAQVSSGLAGPSTPALAAAPGAAADHHHHASSSDDEEDEDLALVRSIRANLHHLHNSKASTVLPDAAPAPRDDDDPSSRPICTWPPSDTDEEEDDLETLRAIQRRFSHYQSSTSTASPKTMKPEASQGVHSDLFADRSGDDFAVQKQNAIVPHGDGFPKAALLLVDALKKNRAYQKFIRRKMVNIEAKIEENKDLRDRVKCLLGYQLSCRKSVSRSLGQKEDPRVRLISPLKSTQPCTKNKYRKIPALFLGPAENPHVSKYEMALKQFPMSFKKQPWSDAEKDKLARGIKQQYQETLILDSLNNGSADGDFSALDMAYALTNGAGNFEVTPENLRSVLPLINWDKISAMYLPGRSGAECESRWLNCDDPLINHEAWTADEETRLLLIIQEKGMCNWIDIAVTLGTYRTPFQCLVRYQRSLNPHILNKAWTKEEDLQLQAAVETFGQKWQLVSASLDGRTGTQCSNRWRKTLHPEKTSVGRWLLDEDKRLMVTVKLIGPGRWSLIAPFIPGRTQTQIFERWCNILDPDLYLDDWRPDEDSTLLAAVSEFGPCWSKISKTIIPGRNDSMCYRRWRKLCKHEVQKAREARQLKKAIFQNNFVDREKERPAICPRDLISLLPSKGDGCDVAIVRYCKFLCSSCILISLGGSEKQGEENHLALSNIVNISSGLDCVAANSVLNASSRRPRRVSSGRRSKKHTEGNNIAAPDDLNASSSAPSSSIKRKSTTGNNVAAKKRSRVSISVNADNEVEKNRITDSVAVSEEGLVKKRTRRPKPVGNEGAVRKRGGSNNEVGTNIITESVAVGEEGVVKKRTRRSKPVGNEGADNEVGTYRITGSVVVGEEGVVKKRTRRSSKPVDNEEVVRKMRGSINNYDEAGTNTMMNSAFGEEEVVKKKTRHSKPVGTEGAASIGGDGMVNKRRTGSVSTENLGAVRKRKIVSSRRKLAEVNLPTEEGVPNAVPDLDFPCAISEERAVDVGNMDKGRRKSTPRPKQINMPEEDADKNSTFTRLVNCLSFARMKGIDRNKR*